Incidental Mutation 'R1277:Slc17a8'
ID150928
Institutional Source Beutler Lab
Gene Symbol Slc17a8
Ensembl Gene ENSMUSG00000019935
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8
SynonymsVglut3
MMRRC Submission 039343-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1277 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location89574020-89621253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89597457 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 51 (T51A)
Ref Sequence ENSEMBL: ENSMUSP00000100932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020102] [ENSMUST00000105295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020102
AA Change: T235A

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020102
Gene: ENSMUSG00000019935
AA Change: T235A

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
internal_repeat_1 62 77 3.74e-7 PROSPERO
internal_repeat_1 75 90 3.74e-7 PROSPERO
Pfam:MFS_1 95 478 1e-46 PFAM
transmembrane domain 493 515 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105295
AA Change: T51A

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100932
Gene: ENSMUSG00000019935
AA Change: T51A

DomainStartEndE-ValueType
Pfam:MFS_1 1 294 1.1e-34 PFAM
transmembrane domain 309 331 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a vesicular glutamate transporter. The encoded protein transports the neurotransmitter glutamate into synaptic vesicles before it is released into the synaptic cleft. Mutations in this gene are the cause of autosomal-dominant nonsyndromic type 25 deafness. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sensorineural hearing loss, cochlear ganglion degeneration, decreased synaptic glutamate release, and nonconvulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Appl1 A C 14: 26,927,856 V571G possibly damaging Het
Chd6 A T 2: 160,967,815 C1509S probably damaging Het
Clk4 A G 11: 51,267,189 T7A probably benign Het
Crlf2 C T 5: 109,557,600 V30I possibly damaging Het
Itpr1 A G 6: 108,339,621 H93R probably benign Het
Lrp1b A G 2: 40,725,945 V3593A probably benign Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Pcdhb11 A T 18: 37,421,716 Y33F possibly damaging Het
Pkd2 A G 5: 104,502,359 I862V probably damaging Het
Prl3c1 T C 13: 27,203,572 L180P probably damaging Het
Ralgps1 A G 2: 33,174,425 V228A possibly damaging Het
Rfx7 A G 9: 72,593,312 E118G probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Zfp414 G T 17: 33,630,475 probably null Het
Other mutations in Slc17a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Slc17a8 APN 10 89591295 missense possibly damaging 0.70
IGL00990:Slc17a8 APN 10 89576530 missense probably benign 0.01
IGL01317:Slc17a8 APN 10 89620804 missense probably benign 0.02
IGL01339:Slc17a8 APN 10 89591244 missense probably damaging 1.00
IGL01468:Slc17a8 APN 10 89592021 critical splice donor site probably null
IGL02401:Slc17a8 APN 10 89576660 splice site probably null
IGL02638:Slc17a8 APN 10 89576603 nonsense probably null
IGL02859:Slc17a8 APN 10 89576584 missense probably benign 0.11
R0518:Slc17a8 UTSW 10 89576330 missense probably benign 0.00
R0521:Slc17a8 UTSW 10 89576330 missense probably benign 0.00
R0610:Slc17a8 UTSW 10 89576626 missense probably damaging 0.99
R0846:Slc17a8 UTSW 10 89606734 missense possibly damaging 0.81
R0928:Slc17a8 UTSW 10 89598683 missense probably damaging 1.00
R1401:Slc17a8 UTSW 10 89591214 missense probably damaging 1.00
R1854:Slc17a8 UTSW 10 89606765 missense unknown
R1935:Slc17a8 UTSW 10 89577915 missense probably benign 0.03
R1936:Slc17a8 UTSW 10 89577915 missense probably benign 0.03
R3887:Slc17a8 UTSW 10 89591138 splice site probably benign
R4227:Slc17a8 UTSW 10 89598713 missense probably damaging 1.00
R4872:Slc17a8 UTSW 10 89576505 missense probably benign 0.38
R5023:Slc17a8 UTSW 10 89576560 missense probably benign 0.01
R5330:Slc17a8 UTSW 10 89589494 critical splice donor site probably null
R5331:Slc17a8 UTSW 10 89589494 critical splice donor site probably null
R5576:Slc17a8 UTSW 10 89597502 missense probably damaging 1.00
R5593:Slc17a8 UTSW 10 89606840 missense probably benign
R6035:Slc17a8 UTSW 10 89592075 missense possibly damaging 0.67
R6035:Slc17a8 UTSW 10 89592075 missense possibly damaging 0.67
R7038:Slc17a8 UTSW 10 89600221 missense probably benign 0.00
R7220:Slc17a8 UTSW 10 89576413 missense probably benign
R7514:Slc17a8 UTSW 10 89592107 missense probably damaging 1.00
R7574:Slc17a8 UTSW 10 89592146 missense probably benign 0.01
R7689:Slc17a8 UTSW 10 89597457 missense possibly damaging 0.80
X0021:Slc17a8 UTSW 10 89598682 missense probably damaging 1.00
X0067:Slc17a8 UTSW 10 89592912 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGCTGTAGACCCAGCACCAT -3'
(R):5'- gggacacaGGCTTTGTATTTGGCAA -3'

Sequencing Primer
(F):5'- cccttcctcccttcccc -3'
(R):5'- GGTTTTGTGAGGCAGCAAT -3'
Posted On2014-01-29