Incidental Mutation 'R1277:Clk4'
ID150929
Institutional Source Beutler Lab
Gene Symbol Clk4
Ensembl Gene ENSMUSG00000020385
Gene NameCDC like kinase 4
Synonyms
MMRRC Submission 039343-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R1277 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51261730-51281766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51267189 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 7 (T7A)
Ref Sequence ENSEMBL: ENSMUSP00000090820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054226] [ENSMUST00000065950] [ENSMUST00000093132] [ENSMUST00000109113] [ENSMUST00000126131] [ENSMUST00000130641] [ENSMUST00000148053] [ENSMUST00000153414]
Predicted Effect probably benign
Transcript: ENSMUST00000054226
SMART Domains Protein: ENSMUSP00000061848
Gene: ENSMUSG00000045942

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065950
SMART Domains Protein: ENSMUSP00000071085
Gene: ENSMUSG00000045942

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093132
AA Change: T7A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090820
Gene: ENSMUSG00000020385
AA Change: T7A

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
S_TKc 159 475 1.58e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109113
SMART Domains Protein: ENSMUSP00000104741
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 225 3.3e-20 PFAM
Pfam:Pkinase 1 295 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126131
SMART Domains Protein: ENSMUSP00000118972
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130641
SMART Domains Protein: ENSMUSP00000123133
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
PDB:2VAG|A 149 182 2e-14 PDB
SCOP:d1howa_ 149 182 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146776
Predicted Effect probably benign
Transcript: ENSMUST00000148053
SMART Domains Protein: ENSMUSP00000120822
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148467
Predicted Effect probably benign
Transcript: ENSMUST00000153414
SMART Domains Protein: ENSMUSP00000115894
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177296
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDC2-like protein kinase (CLK) family. This protein kinase can interact with and phosphorylate the serine- and arginine-rich (SR) proteins, which are known to play an important role in the formation of spliceosomes, and thus may be involved in the regulation of alternative splicing. Studies in the Israeli sand rat Psammomys obesus suggested that the ubiquitin-like 5 (UBL5/BEACON), a highly conserved ubiquitin-like protein, may interact with and regulate the activity of this kinase. Multiple alternatively spliced transcript variants have been observed, but the full-length natures of which have not yet been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Appl1 A C 14: 26,927,856 V571G possibly damaging Het
Chd6 A T 2: 160,967,815 C1509S probably damaging Het
Crlf2 C T 5: 109,557,600 V30I possibly damaging Het
Itpr1 A G 6: 108,339,621 H93R probably benign Het
Lrp1b A G 2: 40,725,945 V3593A probably benign Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Pcdhb11 A T 18: 37,421,716 Y33F possibly damaging Het
Pkd2 A G 5: 104,502,359 I862V probably damaging Het
Prl3c1 T C 13: 27,203,572 L180P probably damaging Het
Ralgps1 A G 2: 33,174,425 V228A possibly damaging Het
Rfx7 A G 9: 72,593,312 E118G probably benign Het
Slc17a8 T C 10: 89,597,457 T51A possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Zfp414 G T 17: 33,630,475 probably null Het
Other mutations in Clk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Clk4 APN 11 51281172 nonsense probably null
B6819:Clk4 UTSW 11 51275766 unclassified probably benign
K7894:Clk4 UTSW 11 51275766 unclassified probably benign
R0001:Clk4 UTSW 11 51268765 splice site probably benign
R0466:Clk4 UTSW 11 51267328 missense possibly damaging 0.59
R0692:Clk4 UTSW 11 51281328 nonsense probably null
R0719:Clk4 UTSW 11 51275493 nonsense probably null
R0723:Clk4 UTSW 11 51275493 nonsense probably null
R1714:Clk4 UTSW 11 51280418 missense probably damaging 1.00
R4804:Clk4 UTSW 11 51281323 missense probably damaging 1.00
R5141:Clk4 UTSW 11 51275771 missense possibly damaging 0.79
R5399:Clk4 UTSW 11 51275257 missense probably damaging 1.00
R6182:Clk4 UTSW 11 51268182 missense possibly damaging 0.66
R6274:Clk4 UTSW 11 51271921 missense possibly damaging 0.69
R6480:Clk4 UTSW 11 51270546 nonsense probably null
R6759:Clk4 UTSW 11 51275574 missense possibly damaging 0.95
R6843:Clk4 UTSW 11 51276249 critical splice donor site probably null
R7138:Clk4 UTSW 11 51277932 missense probably damaging 1.00
R7186:Clk4 UTSW 11 51268780 missense probably benign 0.00
R7235:Clk4 UTSW 11 51276185 missense probably damaging 0.98
R7687:Clk4 UTSW 11 51281398 missense probably benign 0.02
R7842:Clk4 UTSW 11 51281129 missense probably benign 0.00
R7925:Clk4 UTSW 11 51281129 missense probably benign 0.00
R8073:Clk4 UTSW 11 51277889 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGTCAGTTCCATTCAGCATCATCTCAC -3'
(R):5'- TGAGCTACTGTCTCCTATCAATCCCAG -3'

Sequencing Primer
(F):5'- TCAGCATCATCTCACATAGGAGTG -3'
(R):5'- GCAAATGACAACTTGCTGAAAC -3'
Posted On2014-01-29