Incidental Mutation 'R1277:Prl3c1'
ID150930
Institutional Source Beutler Lab
Gene Symbol Prl3c1
Ensembl Gene ENSMUSG00000017922
Gene Nameprolactin family 3, subfamily c, member 1
SynonymsPrlpj, PLP-J, PLP I
MMRRC Submission 039343-MU
Accession Numbers

Genbank: NM_013766, NM_001163218

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1277 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location27196659-27203749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27203572 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 180 (L180P)
Ref Sequence ENSEMBL: ENSMUSP00000136890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018066] [ENSMUST00000110364] [ENSMUST00000178072]
Predicted Effect probably damaging
Transcript: ENSMUST00000018066
AA Change: L200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018066
Gene: ENSMUSG00000017922
AA Change: L200P

DomainStartEndE-ValueType
Pfam:Hormone_1 16 212 1.5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110364
AA Change: L180P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105993
Gene: ENSMUSG00000017922
AA Change: L180P

DomainStartEndE-ValueType
Pfam:Hormone_1 2 192 2.9e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178072
AA Change: L180P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136890
Gene: ENSMUSG00000017922
AA Change: L180P

DomainStartEndE-ValueType
Pfam:Hormone_1 2 192 2.9e-31 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility and a male reproductive tract phenotype that includes enlarged testes and seminal vesicles, increased sperm count, increased serum testosterone and luteinizing hormone levels, and abnormal adult Leydig cell differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Appl1 A C 14: 26,927,856 V571G possibly damaging Het
Chd6 A T 2: 160,967,815 C1509S probably damaging Het
Clk4 A G 11: 51,267,189 T7A probably benign Het
Crlf2 C T 5: 109,557,600 V30I possibly damaging Het
Itpr1 A G 6: 108,339,621 H93R probably benign Het
Lrp1b A G 2: 40,725,945 V3593A probably benign Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Pcdhb11 A T 18: 37,421,716 Y33F possibly damaging Het
Pkd2 A G 5: 104,502,359 I862V probably damaging Het
Ralgps1 A G 2: 33,174,425 V228A possibly damaging Het
Rfx7 A G 9: 72,593,312 E118G probably benign Het
Slc17a8 T C 10: 89,597,457 T51A possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Zfp414 G T 17: 33,630,475 probably null Het
Other mutations in Prl3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Prl3c1 APN 13 27200763 missense probably damaging 0.97
IGL00567:Prl3c1 APN 13 27200712 missense possibly damaging 0.82
IGL01105:Prl3c1 APN 13 27202425 missense probably benign 0.04
IGL02985:Prl3c1 APN 13 27199387 missense probably damaging 0.99
IGL03013:Prl3c1 APN 13 27199366 missense probably benign 0.01
H8930:Prl3c1 UTSW 13 27200706 nonsense probably null
R0437:Prl3c1 UTSW 13 27199464 missense probably benign 0.09
R0630:Prl3c1 UTSW 13 27200691 splice site probably benign
R2064:Prl3c1 UTSW 13 27196737 critical splice donor site probably null
R2121:Prl3c1 UTSW 13 27199342 unclassified probably null
R4752:Prl3c1 UTSW 13 27203525 missense probably benign 0.11
R4959:Prl3c1 UTSW 13 27202488 splice site probably null
R5863:Prl3c1 UTSW 13 27203610 makesense probably null
R7912:Prl3c1 UTSW 13 27199384 missense probably benign 0.02
R7913:Prl3c1 UTSW 13 27199410 missense probably benign 0.00
R8157:Prl3c1 UTSW 13 27199347 missense probably damaging 1.00
Z1177:Prl3c1 UTSW 13 27203501 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CCAAGGAAGTTTACTCAAGGGTGACCA -3'
(R):5'- GCAAAACTCCAGCATTTACACTCCTGTC -3'

Sequencing Primer
(F):5'- ggagggagagagagaggag -3'
(R):5'- tgttgttgttgttgttgtttgttg -3'
Posted On2014-01-29