Incidental Mutation 'R1277:Zfp414'
ID150934
Institutional Source Beutler Lab
Gene Symbol Zfp414
Ensembl Gene ENSMUSG00000073423
Gene Namezinc finger protein 414
Synonyms
MMRRC Submission 039343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R1277 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33629090-33631779 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 33630475 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073570] [ENSMUST00000165504] [ENSMUST00000166627] [ENSMUST00000170225] [ENSMUST00000170225]
Predicted Effect probably null
Transcript: ENSMUST00000073570
SMART Domains Protein: ENSMUSP00000073259
Gene: ENSMUSG00000073423

DomainStartEndE-ValueType
low complexity region 86 95 N/A INTRINSIC
ZnF_C2H2 99 123 1.01e-1 SMART
ZnF_C2H2 135 159 7.49e0 SMART
ZnF_C2H2 166 191 2.61e1 SMART
low complexity region 195 231 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164636
Predicted Effect probably benign
Transcript: ENSMUST00000165504
Predicted Effect probably null
Transcript: ENSMUST00000166627
SMART Domains Protein: ENSMUSP00000129423
Gene: ENSMUSG00000073423

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
ZnF_C2H2 50 74 1.01e-1 SMART
ZnF_C2H2 86 110 7.49e0 SMART
ZnF_C2H2 117 142 2.61e1 SMART
low complexity region 146 182 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169781
Predicted Effect probably null
Transcript: ENSMUST00000170225
SMART Domains Protein: ENSMUSP00000127118
Gene: ENSMUSG00000073423

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
ZnF_C2H2 50 74 1.01e-1 SMART
ZnF_C2H2 86 110 7.49e0 SMART
ZnF_C2H2 117 142 2.61e1 SMART
low complexity region 146 182 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170225
SMART Domains Protein: ENSMUSP00000127118
Gene: ENSMUSG00000073423

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
ZnF_C2H2 50 74 1.01e-1 SMART
ZnF_C2H2 86 110 7.49e0 SMART
ZnF_C2H2 117 142 2.61e1 SMART
low complexity region 146 182 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172455
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Appl1 A C 14: 26,927,856 V571G possibly damaging Het
Chd6 A T 2: 160,967,815 C1509S probably damaging Het
Clk4 A G 11: 51,267,189 T7A probably benign Het
Crlf2 C T 5: 109,557,600 V30I possibly damaging Het
Itpr1 A G 6: 108,339,621 H93R probably benign Het
Lrp1b A G 2: 40,725,945 V3593A probably benign Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Pcdhb11 A T 18: 37,421,716 Y33F possibly damaging Het
Pkd2 A G 5: 104,502,359 I862V probably damaging Het
Prl3c1 T C 13: 27,203,572 L180P probably damaging Het
Ralgps1 A G 2: 33,174,425 V228A possibly damaging Het
Rfx7 A G 9: 72,593,312 E118G probably benign Het
Slc17a8 T C 10: 89,597,457 T51A possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Zfp414
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1453:Zfp414 UTSW 17 33630038 missense probably damaging 1.00
R2473:Zfp414 UTSW 17 33630577 frame shift probably null
R3697:Zfp414 UTSW 17 33630577 frame shift probably null
R4545:Zfp414 UTSW 17 33631648 unclassified probably benign
R5610:Zfp414 UTSW 17 33630038 missense probably damaging 1.00
R7265:Zfp414 UTSW 17 33631279 missense probably benign 0.02
R7836:Zfp414 UTSW 17 33629988 nonsense probably null
R7919:Zfp414 UTSW 17 33629988 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGGGCAGTTTATTCTGACAGTGGC -3'
(R):5'- TCAGGCTCTCACTTGAAGTAGCGG -3'

Sequencing Primer
(F):5'- CTGGGTGGGGAGTAATCAAG -3'
(R):5'- GTGGTTAAGACTAACTCTGGGG -3'
Posted On2014-01-29