Incidental Mutation 'R1278:Mark4'
ID150947
Institutional Source Beutler Lab
Gene Symbol Mark4
Ensembl Gene ENSMUSG00000030397
Gene NameMAP/microtubule affinity regulating kinase 4
SynonymsMarkl1, 2410090P21Rik
MMRRC Submission 039344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1278 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19424775-19458821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19431770 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 533 (S533C)
Ref Sequence ENSEMBL: ENSMUSP00000082862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085715] [ENSMUST00000209058]
Predicted Effect probably damaging
Transcript: ENSMUST00000085715
AA Change: S533C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397
AA Change: S533C

DomainStartEndE-ValueType
S_TKc 59 310 1.4e-109 SMART
UBA 331 368 9.62e-8 SMART
low complexity region 391 408 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
low complexity region 580 586 N/A INTRINSIC
low complexity region 672 690 N/A INTRINSIC
Pfam:KA1 709 752 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208650
Predicted Effect probably benign
Transcript: ENSMUST00000209058
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule affinity-regulating kinase family. These protein kinases phosphorylate microtubule-associated proteins and regulate the transition between stable and dynamic microtubules. The encoded protein is associated with the centrosome throughout mitosis and may be involved in cell cycle control. Expression of this gene is a potential marker for cancer, and the encoded protein may also play a role in Alzheimer's disease. Pseudogenes of this gene are located on both the short and long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit insulin hypersensitivity and resistance to diet-induced obersity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,558,507 S747P probably damaging Het
Adgb A G 10: 10,382,828 Y1063H probably damaging Het
Cacna1d A G 14: 30,178,703 S320P probably damaging Het
Ccdc171 C T 4: 83,661,858 A622V possibly damaging Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Dmxl1 T C 18: 49,893,225 V1800A probably benign Het
Dock5 T C 14: 67,839,566 N276S possibly damaging Het
Fat2 T C 11: 55,268,179 E3389G probably damaging Het
Gm340 A G 19: 41,584,683 T626A probably benign Het
Gnb4 T C 3: 32,587,737 D247G probably damaging Het
Kif20a C T 18: 34,626,777 T75I probably benign Het
Lix1 A G 17: 17,427,207 K45R probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Myo1e T A 9: 70,398,785 V1104D probably damaging Het
Naip6 T C 13: 100,300,362 D551G probably damaging Het
Olfr177 G T 16: 58,872,977 P58T probably damaging Het
Pla2g4e A G 2: 120,168,470 probably null Het
Ror1 T C 4: 100,441,878 F816S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Secisbp2 G T 13: 51,654,510 V104F probably damaging Het
Trpa1 A G 1: 14,918,723 probably null Het
Trpm7 A T 2: 126,825,454 Y846* probably null Het
Other mutations in Mark4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mark4 APN 7 19431824 missense possibly damaging 0.50
IGL02321:Mark4 APN 7 19426389 missense probably benign
IGL02813:Mark4 APN 7 19447256 splice site probably null
IGL03088:Mark4 APN 7 19451584 missense probably damaging 1.00
breakfast UTSW 7 19443226 missense probably damaging 1.00
Towncar UTSW 7 19447243 missense possibly damaging 0.95
R0555:Mark4 UTSW 7 19448673 splice site probably benign
R1385:Mark4 UTSW 7 19426027 unclassified probably null
R3415:Mark4 UTSW 7 19451725 missense probably benign 0.00
R3828:Mark4 UTSW 7 19443187 missense possibly damaging 0.65
R4281:Mark4 UTSW 7 19433446 missense probably benign 0.09
R4682:Mark4 UTSW 7 19445172 splice site probably null
R4791:Mark4 UTSW 7 19451657 missense probably benign 0.19
R5184:Mark4 UTSW 7 19447243 missense possibly damaging 0.95
R5319:Mark4 UTSW 7 19436961 missense possibly damaging 0.95
R5330:Mark4 UTSW 7 19436983 missense probably damaging 1.00
R5488:Mark4 UTSW 7 19429607 splice site probably null
R5811:Mark4 UTSW 7 19448639 missense probably damaging 1.00
R6058:Mark4 UTSW 7 19426385 missense probably benign 0.10
R6148:Mark4 UTSW 7 19429516 missense probably benign 0.00
R6333:Mark4 UTSW 7 19443283 missense probably damaging 0.98
R6698:Mark4 UTSW 7 19429437 missense probably benign 0.01
R7265:Mark4 UTSW 7 19451725 missense probably benign 0.00
R7429:Mark4 UTSW 7 19426167 missense probably damaging 0.99
R7664:Mark4 UTSW 7 19443226 missense probably damaging 1.00
R8027:Mark4 UTSW 7 19447239 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCGGGAATCACTCACTTCCTATGC -3'
(R):5'- TGAGAGAGTCTTCTCATCTCCTGGC -3'

Sequencing Primer
(F):5'- TTTTTACCAAGGGGGAGCAC -3'
(R):5'- CTGGCCCCTCTTGGTGTG -3'
Posted On2014-01-29