Incidental Mutation 'R1278:Myo1e'
ID150950
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission 039344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1278 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70398785 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1104 (V1104D)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
PDB Structure
MYOSIN 1E SH3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034745
AA Change: V1104D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: V1104D

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,558,507 S747P probably damaging Het
Adgb A G 10: 10,382,828 Y1063H probably damaging Het
Cacna1d A G 14: 30,178,703 S320P probably damaging Het
Ccdc171 C T 4: 83,661,858 A622V possibly damaging Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Dmxl1 T C 18: 49,893,225 V1800A probably benign Het
Dock5 T C 14: 67,839,566 N276S possibly damaging Het
Fat2 T C 11: 55,268,179 E3389G probably damaging Het
Gm340 A G 19: 41,584,683 T626A probably benign Het
Gnb4 T C 3: 32,587,737 D247G probably damaging Het
Kif20a C T 18: 34,626,777 T75I probably benign Het
Lix1 A G 17: 17,427,207 K45R probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Mark4 T A 7: 19,431,770 S533C probably damaging Het
Naip6 T C 13: 100,300,362 D551G probably damaging Het
Olfr177 G T 16: 58,872,977 P58T probably damaging Het
Pla2g4e A G 2: 120,168,470 probably null Het
Ror1 T C 4: 100,441,878 F816S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Secisbp2 G T 13: 51,654,510 V104F probably damaging Het
Trpa1 A G 1: 14,918,723 probably null Het
Trpm7 A T 2: 126,825,454 Y846* probably null Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 splice site probably null
R5414:Myo1e UTSW 9 70322358 splice site probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
R7084:Myo1e UTSW 9 70337801 missense probably damaging 0.96
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
R7383:Myo1e UTSW 9 70297295 missense probably damaging 1.00
R7811:Myo1e UTSW 9 70327262 missense probably damaging 0.96
R7962:Myo1e UTSW 9 70335219 missense possibly damaging 0.64
R8309:Myo1e UTSW 9 70346763 missense possibly damaging 0.90
R8510:Myo1e UTSW 9 70335265 missense probably damaging 1.00
R8513:Myo1e UTSW 9 70320088 missense probably damaging 1.00
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGCAGGCCATTCTGTACAAGAAACC -3'
(R):5'- AAGGCACTTGTCATCGAGTCACCG -3'

Sequencing Primer
(F):5'- TTCTGTACAAGAAACCTTTTCCCAAC -3'
(R):5'- GTGGAGTGACCCATAACTTGTCC -3'
Posted On2014-01-29