Incidental Mutation 'R1278:Secisbp2'
ID 150954
Institutional Source Beutler Lab
Gene Symbol Secisbp2
Ensembl Gene ENSMUSG00000035139
Gene Name SECIS binding protein 2
Synonyms SBP2, 2210413N07Rik, 2810012K13Rik
MMRRC Submission 039344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R1278 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 51651697-51684044 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 51654510 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 104 (V104F)
Ref Sequence ENSEMBL: ENSMUSP00000105671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040117] [ENSMUST00000075853] [ENSMUST00000110044]
AlphaFold Q3U1C4
Predicted Effect probably damaging
Transcript: ENSMUST00000040117
AA Change: V104F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045740
Gene: ENSMUSG00000035139
AA Change: V104F

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 662 764 4.4e-23 PFAM
low complexity region 793 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075853
SMART Domains Protein: ENSMUSP00000075250
Gene: ENSMUSG00000062248

DomainStartEndE-ValueType
CKS 5 74 2.41e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110044
AA Change: V104F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105671
Gene: ENSMUSG00000035139
AA Change: V104F

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154202
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: The incorporation of selenocysteine into a protein requires the concerted action of an mRNA element called a sec insertion sequence (SECIS), a selenocysteine-specific translation elongation factor and a SECIS binding protein. With these elements in place, a UGA codon can be decoded as selenocysteine. The gene described in this record encodes a nuclear protein that functions as a SECIS binding protein. Mutations in a similar gene in human have been associated with a reduction in activity of a specific thyroxine deiodinase, a selenocysteine-containing enzyme, and abnormal thyroid hormone metabolism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality while heterozygotes exhibit reduced serum selenium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,558,507 S747P probably damaging Het
Adgb A G 10: 10,382,828 Y1063H probably damaging Het
Cacna1d A G 14: 30,178,703 S320P probably damaging Het
Ccdc171 C T 4: 83,661,858 A622V possibly damaging Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Dmxl1 T C 18: 49,893,225 V1800A probably benign Het
Dock5 T C 14: 67,839,566 N276S possibly damaging Het
Fat2 T C 11: 55,268,179 E3389G probably damaging Het
Gm340 A G 19: 41,584,683 T626A probably benign Het
Gnb4 T C 3: 32,587,737 D247G probably damaging Het
Kif20a C T 18: 34,626,777 T75I probably benign Het
Lix1 A G 17: 17,427,207 K45R probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Mark4 T A 7: 19,431,770 S533C probably damaging Het
Myo1e T A 9: 70,398,785 V1104D probably damaging Het
Naip6 T C 13: 100,300,362 D551G probably damaging Het
Olfr177 G T 16: 58,872,977 P58T probably damaging Het
Pla2g4e A G 2: 120,168,470 probably null Het
Ror1 T C 4: 100,441,878 F816S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Trpa1 A G 1: 14,918,723 probably null Het
Trpm7 A T 2: 126,825,454 Y846* probably null Het
Other mutations in Secisbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Secisbp2 APN 13 51676455 critical splice donor site probably null
IGL01316:Secisbp2 APN 13 51654516 missense probably benign 0.06
IGL02576:Secisbp2 APN 13 51670858 missense possibly damaging 0.80
IGL02630:Secisbp2 APN 13 51678906 missense possibly damaging 0.63
IGL02645:Secisbp2 APN 13 51682460 missense probably damaging 1.00
IGL03107:Secisbp2 APN 13 51652757 critical splice donor site probably null
R0208:Secisbp2 UTSW 13 51679845 missense probably benign 0.26
R0453:Secisbp2 UTSW 13 51683325 missense possibly damaging 0.91
R1220:Secisbp2 UTSW 13 51656905 missense probably damaging 1.00
R1439:Secisbp2 UTSW 13 51679723 splice site probably benign
R1514:Secisbp2 UTSW 13 51682095 missense possibly damaging 0.83
R1568:Secisbp2 UTSW 13 51673107 missense possibly damaging 0.73
R1724:Secisbp2 UTSW 13 51670846 missense probably benign
R2851:Secisbp2 UTSW 13 51654635 splice site probably null
R2967:Secisbp2 UTSW 13 51670879 missense probably benign 0.00
R3156:Secisbp2 UTSW 13 51662675 missense probably benign 0.06
R4393:Secisbp2 UTSW 13 51654466 missense probably damaging 1.00
R4719:Secisbp2 UTSW 13 51652732 missense possibly damaging 0.96
R4953:Secisbp2 UTSW 13 51682027 missense probably damaging 1.00
R5183:Secisbp2 UTSW 13 51665424 missense probably benign 0.14
R5432:Secisbp2 UTSW 13 51673966 small deletion probably benign
R5696:Secisbp2 UTSW 13 51679821 missense probably damaging 1.00
R6007:Secisbp2 UTSW 13 51665359 missense probably damaging 0.99
R6066:Secisbp2 UTSW 13 51677222 missense probably benign 0.00
R6076:Secisbp2 UTSW 13 51679777 missense probably damaging 0.98
R6164:Secisbp2 UTSW 13 51679860 missense probably damaging 1.00
R6346:Secisbp2 UTSW 13 51679887 missense probably damaging 0.99
R6367:Secisbp2 UTSW 13 51682141 missense probably damaging 1.00
R6790:Secisbp2 UTSW 13 51670903 missense probably benign 0.09
R6888:Secisbp2 UTSW 13 51679941 missense probably benign 0.16
R7095:Secisbp2 UTSW 13 51677254 missense probably benign 0.01
R7104:Secisbp2 UTSW 13 51656907 nonsense probably null
R7261:Secisbp2 UTSW 13 51682462 missense probably damaging 1.00
R7717:Secisbp2 UTSW 13 51673098 missense probably benign 0.00
R7986:Secisbp2 UTSW 13 51665359 missense probably damaging 0.99
R8021:Secisbp2 UTSW 13 51665628 makesense probably null
R8496:Secisbp2 UTSW 13 51665347 missense probably damaging 1.00
R8755:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8757:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8758:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8759:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8833:Secisbp2 UTSW 13 51665316 missense probably benign 0.01
R8878:Secisbp2 UTSW 13 51683368 missense probably benign 0.13
R9153:Secisbp2 UTSW 13 51679819 missense possibly damaging 0.92
R9295:Secisbp2 UTSW 13 51654447 missense probably damaging 1.00
R9528:Secisbp2 UTSW 13 51656943 missense possibly damaging 0.57
R9562:Secisbp2 UTSW 13 51683284 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTTCCAATGCGAAAGTAAGTGATCCT -3'
(R):5'- CACTGACTTCTGACACTGGCAACAA -3'

Sequencing Primer
(F):5'- TGCGAAAGTAAGTGATCCTTAAAAG -3'
(R):5'- TGACACTGGCAACAAGGACTAAG -3'
Posted On 2014-01-29