Incidental Mutation 'R1278:Olfr177'
ID150958
Institutional Source Beutler Lab
Gene Symbol Olfr177
Ensembl Gene ENSMUSG00000063137
Gene Nameolfactory receptor 177
SynonymsGA_x54KRFPKG5P-55091371-55090442, MOR184-7
MMRRC Submission 039344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1278 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58870955-58874768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58872977 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 58 (P58T)
Ref Sequence ENSEMBL: ENSMUSP00000150269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072853] [ENSMUST00000217377]
Predicted Effect probably damaging
Transcript: ENSMUST00000072853
AA Change: P58T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072631
Gene: ENSMUSG00000063137
AA Change: P58T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 254 8.3e-6 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205920
AA Change: P58T
Predicted Effect probably damaging
Transcript: ENSMUST00000217377
AA Change: P58T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,558,507 S747P probably damaging Het
Adgb A G 10: 10,382,828 Y1063H probably damaging Het
Cacna1d A G 14: 30,178,703 S320P probably damaging Het
Ccdc171 C T 4: 83,661,858 A622V possibly damaging Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Dmxl1 T C 18: 49,893,225 V1800A probably benign Het
Dock5 T C 14: 67,839,566 N276S possibly damaging Het
Fat2 T C 11: 55,268,179 E3389G probably damaging Het
Gm340 A G 19: 41,584,683 T626A probably benign Het
Gnb4 T C 3: 32,587,737 D247G probably damaging Het
Kif20a C T 18: 34,626,777 T75I probably benign Het
Lix1 A G 17: 17,427,207 K45R probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Mark4 T A 7: 19,431,770 S533C probably damaging Het
Myo1e T A 9: 70,398,785 V1104D probably damaging Het
Naip6 T C 13: 100,300,362 D551G probably damaging Het
Pla2g4e A G 2: 120,168,470 probably null Het
Ror1 T C 4: 100,441,878 F816S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Secisbp2 G T 13: 51,654,510 V104F probably damaging Het
Trpa1 A G 1: 14,918,723 probably null Het
Trpm7 A T 2: 126,825,454 Y846* probably null Het
Other mutations in Olfr177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Olfr177 APN 16 58873036 missense probably damaging 1.00
IGL02223:Olfr177 APN 16 58872694 missense probably damaging 1.00
R0131:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0131:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0132:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0245:Olfr177 UTSW 16 58872866 missense probably benign 0.01
R0717:Olfr177 UTSW 16 58872770 missense probably damaging 1.00
R0975:Olfr177 UTSW 16 58873150 splice site probably null
R1037:Olfr177 UTSW 16 58872970 missense probably damaging 1.00
R1256:Olfr177 UTSW 16 58872843 nonsense probably null
R1538:Olfr177 UTSW 16 58872898 missense probably damaging 1.00
R1992:Olfr177 UTSW 16 58872511 missense probably benign 0.43
R2173:Olfr177 UTSW 16 58872619 missense probably damaging 0.99
R2392:Olfr177 UTSW 16 58872434 missense probably damaging 1.00
R5651:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R5652:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R5653:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R8031:Olfr177 UTSW 16 58872691 missense probably benign 0.03
R8108:Olfr177 UTSW 16 58872236 missense probably benign
R8531:Olfr177 UTSW 16 58872653 missense probably damaging 1.00
R8833:Olfr177 UTSW 16 58872596 missense probably damaging 0.99
V8831:Olfr177 UTSW 16 58873075 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GAGGGTTGCATATAGCCACATAGCG -3'
(R):5'- CCCTTGTCAACAGAGGAGCTGAAG -3'

Sequencing Primer
(F):5'- TATAGCCACATAGCGGTCATAG -3'
(R):5'- CTGAAGATGACTGAGGACAACTACTC -3'
Posted On2014-01-29