Incidental Mutation 'R1279:Padi3'
ID150969
Institutional Source Beutler Lab
Gene Symbol Padi3
Ensembl Gene ENSMUSG00000025328
Gene Namepeptidyl arginine deiminase, type III
SynonymsPAD type III, Pdi3, Pad3
MMRRC Submission 039345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1279 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location140785365-140810648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140803577 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 45 (S45G)
Ref Sequence ENSEMBL: ENSMUSP00000130721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026377] [ENSMUST00000172098]
Predicted Effect probably benign
Transcript: ENSMUST00000026377
AA Change: S55G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026377
Gene: ENSMUSG00000025328
AA Change: S55G

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 2.1e-38 PFAM
Pfam:PAD_M 115 273 4.2e-61 PFAM
Pfam:PAD 283 661 2.3e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172098
AA Change: S45G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130721
Gene: ENSMUSG00000025328
AA Change: S45G

DomainStartEndE-ValueType
Pfam:PAD_N 14 103 3.9e-29 PFAM
Pfam:PAD_M 105 263 2.9e-69 PFAM
Pfam:PAD 268 654 5.3e-226 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type III enzyme modulates hair structural proteins, such as filaggrin in the hair follicle and trichohyalin in the inner root sheath, during hair follicle formation. Together with the type I enzyme, this enzyme may also play a role in terminal differentiation of the epidermis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit alterations in coat/ hair and vibrissa morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Atp6v0d2 A T 4: 19,878,298 M325K probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm10436 C T 12: 88,175,880 V323M probably benign Het
Gm17305 TCTCCTCCTCCTCCTCCTCCTC TCTCCTCCTCCTCCTCCTC 11: 69,369,349 probably benign Het
Mfap5 A G 6: 122,526,763 probably null Het
Nrcam T C 12: 44,544,877 probably null Het
Oas1a A G 5: 120,897,178 probably null Het
Oat A T 7: 132,567,080 L137H probably damaging Het
Olfr135 A G 17: 38,208,787 I181V probably benign Het
Olfr1564 T C 17: 33,216,326 Y6C possibly damaging Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Pias1 A G 9: 62,892,145 S488P probably damaging Het
Plxnb2 G A 15: 89,162,321 T873I probably benign Het
Ppp4r2 A T 6: 100,865,918 R176* probably null Het
Prkdc A T 16: 15,690,282 L932F probably damaging Het
Ros1 C A 10: 52,142,166 A799S possibly damaging Het
Scn4a A T 11: 106,335,682 I684N probably damaging Het
Sypl2 A G 3: 108,217,674 F124L probably damaging Het
Tacr1 G T 6: 82,557,183 E397* probably null Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Vmn1r7 T C 6: 57,024,949 T109A possibly damaging Het
Zp1 A G 19: 10,918,577 S232P probably damaging Het
Other mutations in Padi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Padi3 APN 4 140803624 missense possibly damaging 0.78
IGL00948:Padi3 APN 4 140788943 missense possibly damaging 0.92
IGL00949:Padi3 APN 4 140788943 missense possibly damaging 0.92
IGL01021:Padi3 APN 4 140796334 splice site probably benign
IGL02400:Padi3 APN 4 140788868 missense probably benign 0.00
IGL02449:Padi3 APN 4 140789712 critical splice donor site probably null
IGL02600:Padi3 APN 4 140798156 missense probably benign 0.15
IGL03342:Padi3 APN 4 140810598 nonsense probably null
FR4304:Padi3 UTSW 4 140792972 critical splice donor site probably benign
PIT4544001:Padi3 UTSW 4 140791483 missense probably benign 0.00
R0455:Padi3 UTSW 4 140795713 missense probably damaging 1.00
R0743:Padi3 UTSW 4 140786429 missense probably benign 0.00
R2081:Padi3 UTSW 4 140798979 missense probably damaging 1.00
R3016:Padi3 UTSW 4 140786587 missense probably damaging 1.00
R3853:Padi3 UTSW 4 140791269 splice site probably benign
R4599:Padi3 UTSW 4 140798111 missense probably damaging 1.00
R4909:Padi3 UTSW 4 140795626 missense probably damaging 1.00
R5370:Padi3 UTSW 4 140810538 nonsense probably null
R5482:Padi3 UTSW 4 140795843 missense probably damaging 0.99
R6084:Padi3 UTSW 4 140795843 missense probably damaging 1.00
R6151:Padi3 UTSW 4 140796394 missense probably damaging 1.00
R6277:Padi3 UTSW 4 140791161 critical splice donor site probably null
R6343:Padi3 UTSW 4 140803508 missense possibly damaging 0.58
R6749:Padi3 UTSW 4 140795853 missense possibly damaging 0.94
R7096:Padi3 UTSW 4 140800124 missense probably damaging 1.00
R7403:Padi3 UTSW 4 140800119 missense probably benign
R7798:Padi3 UTSW 4 140786439 missense probably benign
R7818:Padi3 UTSW 4 140798142 missense possibly damaging 0.72
R8375:Padi3 UTSW 4 140798096 missense probably damaging 1.00
R8887:Padi3 UTSW 4 140796484 nonsense probably null
RF025:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF032:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF040:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF043:Padi3 UTSW 4 140792972 critical splice donor site probably benign
Z1176:Padi3 UTSW 4 140795671 missense possibly damaging 0.92
Z1176:Padi3 UTSW 4 140798123 missense not run
Z1177:Padi3 UTSW 4 140798123 missense not run
Predicted Primers PCR Primer
(F):5'- GCTGGTCAAACAGCAGATACTCAGG -3'
(R):5'- CCAGGGACATTGGAATCTCAGCAC -3'

Sequencing Primer
(F):5'- agaacacacagccagcac -3'
(R):5'- TGCTGTGAGTggctcgg -3'
Posted On2014-01-29