Incidental Mutation 'R1279:Oas1a'
ID150970
Institutional Source Beutler Lab
Gene Symbol Oas1a
Ensembl Gene ENSMUSG00000052776
Gene Name2'-5' oligoadenylate synthetase 1A
SynonymsL3
MMRRC Submission 039345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1279 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120896256-120907521 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 120897178 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080322]
Predicted Effect probably null
Transcript: ENSMUST00000080322
SMART Domains Protein: ENSMUSP00000079198
Gene: ENSMUSG00000052776

DomainStartEndE-ValueType
Pfam:NTP_transf_2 38 139 9.8e-14 PFAM
Pfam:OAS1_C 164 349 1.9e-87 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Atp6v0d2 A T 4: 19,878,298 M325K probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm10436 C T 12: 88,175,880 V323M probably benign Het
Gm17305 TCTCCTCCTCCTCCTCCTCCTC TCTCCTCCTCCTCCTCCTC 11: 69,369,349 probably benign Het
Mfap5 A G 6: 122,526,763 probably null Het
Nrcam T C 12: 44,544,877 probably null Het
Oat A T 7: 132,567,080 L137H probably damaging Het
Olfr135 A G 17: 38,208,787 I181V probably benign Het
Olfr1564 T C 17: 33,216,326 Y6C possibly damaging Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Padi3 T C 4: 140,803,577 S45G probably benign Het
Pias1 A G 9: 62,892,145 S488P probably damaging Het
Plxnb2 G A 15: 89,162,321 T873I probably benign Het
Ppp4r2 A T 6: 100,865,918 R176* probably null Het
Prkdc A T 16: 15,690,282 L932F probably damaging Het
Ros1 C A 10: 52,142,166 A799S possibly damaging Het
Scn4a A T 11: 106,335,682 I684N probably damaging Het
Sypl2 A G 3: 108,217,674 F124L probably damaging Het
Tacr1 G T 6: 82,557,183 E397* probably null Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Vmn1r7 T C 6: 57,024,949 T109A possibly damaging Het
Zp1 A G 19: 10,918,577 S232P probably damaging Het
Other mutations in Oas1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01822:Oas1a APN 5 120899214 missense probably benign 0.01
IGL02299:Oas1a APN 5 120905692 missense probably benign
IGL02951:Oas1a APN 5 120905664 missense probably damaging 1.00
IGL03112:Oas1a APN 5 120898349 missense possibly damaging 0.95
IGL03230:Oas1a APN 5 120898356 missense probably benign 0.23
IGL03356:Oas1a APN 5 120905845 missense probably damaging 0.99
IGL03379:Oas1a APN 5 120896999 missense possibly damaging 0.70
R0625:Oas1a UTSW 5 120899259 missense probably damaging 1.00
R1914:Oas1a UTSW 5 120905813 missense possibly damaging 0.48
R1915:Oas1a UTSW 5 120905813 missense possibly damaging 0.48
R4758:Oas1a UTSW 5 120907338 missense probably damaging 1.00
R4928:Oas1a UTSW 5 120905724 missense probably benign
R5267:Oas1a UTSW 5 120899221 missense probably benign 0.00
R5442:Oas1a UTSW 5 120897206 missense probably benign 0.00
R5487:Oas1a UTSW 5 120907427 missense probably damaging 1.00
R6853:Oas1a UTSW 5 120907428 missense possibly damaging 0.95
R6880:Oas1a UTSW 5 120901940 missense probably damaging 0.97
R7953:Oas1a UTSW 5 120897017 missense probably benign 0.32
R8043:Oas1a UTSW 5 120897017 missense probably benign 0.32
R8363:Oas1a UTSW 5 120905839 missense probably damaging 1.00
R8738:Oas1a UTSW 5 120901956 missense probably damaging 1.00
R8863:Oas1a UTSW 5 120905880 missense probably damaging 1.00
Z1177:Oas1a UTSW 5 120901895 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GCTCACAGCAGGATACATGTCCAG -3'
(R):5'- GCGTGATGCTAGGGAACTGATGATG -3'

Sequencing Primer
(F):5'- AGCAGGATACATGTCCAGTTCTC -3'
(R):5'- TGCTGTCCTGCAACTGAGAG -3'
Posted On2014-01-29