Incidental Mutation 'R1279:Vmn1r7'
ID150971
Institutional Source Beutler Lab
Gene Symbol Vmn1r7
Ensembl Gene ENSMUSG00000093696
Gene Namevomeronasal 1 receptor 7
SynonymsGm5568, V1rc31
MMRRC Submission 039345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R1279 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57024106-57025324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57024949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 109 (T109A)
Ref Sequence ENSEMBL: ENSMUSP00000135571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000176252
AA Change: T109A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135571
Gene: ENSMUSG00000093696
AA Change: T109A

DomainStartEndE-ValueType
Pfam:V1R 28 293 1.1e-59 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Atp6v0d2 A T 4: 19,878,298 M325K probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm10436 C T 12: 88,175,880 V323M probably benign Het
Gm17305 TCTCCTCCTCCTCCTCCTCCTC TCTCCTCCTCCTCCTCCTC 11: 69,369,349 probably benign Het
Mfap5 A G 6: 122,526,763 probably null Het
Nrcam T C 12: 44,544,877 probably null Het
Oas1a A G 5: 120,897,178 probably null Het
Oat A T 7: 132,567,080 L137H probably damaging Het
Olfr135 A G 17: 38,208,787 I181V probably benign Het
Olfr1564 T C 17: 33,216,326 Y6C possibly damaging Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Padi3 T C 4: 140,803,577 S45G probably benign Het
Pias1 A G 9: 62,892,145 S488P probably damaging Het
Plxnb2 G A 15: 89,162,321 T873I probably benign Het
Ppp4r2 A T 6: 100,865,918 R176* probably null Het
Prkdc A T 16: 15,690,282 L932F probably damaging Het
Ros1 C A 10: 52,142,166 A799S possibly damaging Het
Scn4a A T 11: 106,335,682 I684N probably damaging Het
Sypl2 A G 3: 108,217,674 F124L probably damaging Het
Tacr1 G T 6: 82,557,183 E397* probably null Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Zp1 A G 19: 10,918,577 S232P probably damaging Het
Other mutations in Vmn1r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Vmn1r7 APN 6 57024723 missense probably damaging 1.00
IGL01528:Vmn1r7 APN 6 57024547 missense probably benign
IGL02024:Vmn1r7 APN 6 57024889 missense probably benign 0.01
IGL02234:Vmn1r7 APN 6 57024552 missense probably damaging 0.98
IGL02610:Vmn1r7 APN 6 57025052 missense probably benign 0.01
IGL02691:Vmn1r7 APN 6 57024388 missense probably benign 0.05
R0529:Vmn1r7 UTSW 6 57024465 missense possibly damaging 0.78
R0548:Vmn1r7 UTSW 6 57025081 missense probably damaging 0.96
R1254:Vmn1r7 UTSW 6 57024787 missense probably damaging 1.00
R1582:Vmn1r7 UTSW 6 57025158 missense probably damaging 1.00
R1973:Vmn1r7 UTSW 6 57025026 missense probably benign 0.00
R1991:Vmn1r7 UTSW 6 57024868 missense probably benign 0.37
R2160:Vmn1r7 UTSW 6 57024894 missense probably damaging 0.97
R3546:Vmn1r7 UTSW 6 57024849 missense possibly damaging 0.80
R3547:Vmn1r7 UTSW 6 57024849 missense possibly damaging 0.80
R5901:Vmn1r7 UTSW 6 57024606 missense probably damaging 1.00
R6294:Vmn1r7 UTSW 6 57024419 missense probably benign 0.00
R7063:Vmn1r7 UTSW 6 57024433 missense possibly damaging 0.63
R7192:Vmn1r7 UTSW 6 57024467 missense probably benign 0.00
R7647:Vmn1r7 UTSW 6 57025270 missense probably benign 0.01
R7781:Vmn1r7 UTSW 6 57024568 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCATTGCCTCTGATGCCTGAAC -3'
(R):5'- AGACCTGATCTCCTGTCAACTGTCC -3'

Sequencing Primer
(F):5'- ACACTTGTAGTCAGCATGACTC -3'
(R):5'- CAACTGTCCTTTGTTCACATAATGG -3'
Posted On2014-01-29