Incidental Mutation 'R1279:Gm10436'
ID150982
Institutional Source Beutler Lab
Gene Symbol Gm10436
Ensembl Gene ENSMUSG00000066027
Gene Namepredicted gene 10436
Synonyms
MMRRC Submission 039345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1279 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location88175589-88182108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88175880 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 323 (V323M)
Ref Sequence ENSEMBL: ENSMUSP00000152292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071580] [ENSMUST00000220521] [ENSMUST00000222081] [ENSMUST00000223172]
Predicted Effect probably benign
Transcript: ENSMUST00000071580
AA Change: V518M

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071508
Gene: ENSMUSG00000066027
AA Change: V518M

DomainStartEndE-ValueType
SCOP:d1a4ya_ 247 445 5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220521
AA Change: V323M

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000221884
Predicted Effect probably benign
Transcript: ENSMUST00000222081
Predicted Effect probably benign
Transcript: ENSMUST00000222391
Predicted Effect probably benign
Transcript: ENSMUST00000222556
Predicted Effect probably benign
Transcript: ENSMUST00000223172
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Atp6v0d2 A T 4: 19,878,298 M325K probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm17305 TCTCCTCCTCCTCCTCCTCCTC TCTCCTCCTCCTCCTCCTC 11: 69,369,349 probably benign Het
Mfap5 A G 6: 122,526,763 probably null Het
Nrcam T C 12: 44,544,877 probably null Het
Oas1a A G 5: 120,897,178 probably null Het
Oat A T 7: 132,567,080 L137H probably damaging Het
Olfr135 A G 17: 38,208,787 I181V probably benign Het
Olfr1564 T C 17: 33,216,326 Y6C possibly damaging Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Padi3 T C 4: 140,803,577 S45G probably benign Het
Pias1 A G 9: 62,892,145 S488P probably damaging Het
Plxnb2 G A 15: 89,162,321 T873I probably benign Het
Ppp4r2 A T 6: 100,865,918 R176* probably null Het
Prkdc A T 16: 15,690,282 L932F probably damaging Het
Ros1 C A 10: 52,142,166 A799S possibly damaging Het
Scn4a A T 11: 106,335,682 I684N probably damaging Het
Sypl2 A G 3: 108,217,674 F124L probably damaging Het
Tacr1 G T 6: 82,557,183 E397* probably null Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Vmn1r7 T C 6: 57,024,949 T109A possibly damaging Het
Zp1 A G 19: 10,918,577 S232P probably damaging Het
Other mutations in Gm10436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gm10436 APN 12 88177112 missense probably benign 0.35
IGL01391:Gm10436 APN 12 88178455 missense possibly damaging 0.84
IGL01432:Gm10436 APN 12 88176432 missense probably benign 0.44
IGL01519:Gm10436 APN 12 88177561 missense probably benign 0.00
IGL01784:Gm10436 APN 12 88176315 missense probably benign
IGL02121:Gm10436 APN 12 88178472 missense possibly damaging 0.83
IGL02728:Gm10436 APN 12 88176022 missense probably benign 0.17
R0336:Gm10436 UTSW 12 88178191 missense probably benign 0.20
R0554:Gm10436 UTSW 12 88177558 missense probably benign 0.10
R1832:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1833:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1900:Gm10436 UTSW 12 88177260 missense probably benign 0.02
R2412:Gm10436 UTSW 12 88177110 missense probably damaging 0.98
R3040:Gm10436 UTSW 12 88178348 missense probably benign 0.00
R3625:Gm10436 UTSW 12 88175961 missense probably benign 0.06
R4078:Gm10436 UTSW 12 88175913 missense probably benign 0.38
R4270:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R4271:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R5318:Gm10436 UTSW 12 88176228 missense probably benign 0.01
R5552:Gm10436 UTSW 12 88178365 missense probably benign 0.03
R5601:Gm10436 UTSW 12 88176047 missense probably damaging 1.00
R5881:Gm10436 UTSW 12 88176341 missense probably damaging 1.00
R5973:Gm10436 UTSW 12 88175913 missense probably benign 0.02
R6058:Gm10436 UTSW 12 88177225 missense possibly damaging 0.91
R6488:Gm10436 UTSW 12 88177587 missense possibly damaging 0.87
R6656:Gm10436 UTSW 12 88175993 missense possibly damaging 0.89
R7307:Gm10436 UTSW 12 88181749 missense probably damaging 1.00
R7332:Gm10436 UTSW 12 88176417 missense possibly damaging 0.72
R7544:Gm10436 UTSW 12 88176080 missense probably benign 0.00
R7569:Gm10436 UTSW 12 88176315 missense probably benign
R7645:Gm10436 UTSW 12 88176258 missense probably damaging 1.00
R7752:Gm10436 UTSW 12 88175999 missense probably damaging 1.00
R7855:Gm10436 UTSW 12 88176083 missense probably benign 0.03
R7860:Gm10436 UTSW 12 88176352 missense possibly damaging 0.89
R8113:Gm10436 UTSW 12 88177080 missense probably benign 0.00
R8356:Gm10436 UTSW 12 88177216 missense probably benign 0.01
R8456:Gm10436 UTSW 12 88177216 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGCCAGTCTCATAAAATGGTGC -3'
(R):5'- CCCTAAGCCAATGTTCTCACCTCAG -3'

Sequencing Primer
(F):5'- GCTTGATTCTTTCTACAGATGCAAC -3'
(R):5'- GCCCCTATAGAGTGCTATGATGAC -3'
Posted On2014-01-29