Mutagenetix > Incidental Mutations

Incidental Mutation 'R1279:Plxnb2'

150983

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

039345-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R1279 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 89162321 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 873 (T873I)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

Predicted Effect

probably benign
Transcript: ENSMUST00000060808
AA Change: T873I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: T873I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109331
AA Change: T873I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: T873I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131062

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230393

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Atp6v0d2	A	T	4: 19,878,298	M325K	probably benign	Het
Gjb3	G	A	4: 127,326,431	R103W	probably damaging	Het
Gm10436	C	T	12: 88,175,880	V323M	probably benign	Het
Gm17305	TCTCCTCCTCCTCCTCCTCCTC	TCTCCTCCTCCTCCTCCTC	11: 69,369,349		probably benign	Het
Mfap5	A	G	6: 122,526,763		probably null	Het
Nrcam	T	C	12: 44,544,877		probably null	Het
Oas1a	A	G	5: 120,897,178		probably null	Het
Oat	A	T	7: 132,567,080	L137H	probably damaging	Het
Olfr135	A	G	17: 38,208,787	I181V	probably benign	Het
Olfr1564	T	C	17: 33,216,326	Y6C	possibly damaging	Het
Olfr183	G	A	16: 59,000,138	G151D	possibly damaging	Het
Padi3	T	C	4: 140,803,577	S45G	probably benign	Het
Pias1	A	G	9: 62,892,145	S488P	probably damaging	Het
Ppp4r2	A	T	6: 100,865,918	R176*	probably null	Het
Prkdc	A	T	16: 15,690,282	L932F	probably damaging	Het
Ros1	C	A	10: 52,142,166	A799S	possibly damaging	Het
Scn4a	A	T	11: 106,335,682	I684N	probably damaging	Het
Sypl2	A	G	3: 108,217,674	F124L	probably damaging	Het
Tacr1	G	T	6: 82,557,183	E397*	probably null	Het
Uhrf1bp1	T	C	17: 27,890,071	F1088S	possibly damaging	Het
Vmn1r7	T	C	6: 57,024,949	T109A	possibly damaging	Het
Zp1	A	G	19: 10,918,577	S232P	probably damaging	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGAGTGTCACCCGCACATCC -3'
(R):5'- GCCAGAACTGTGCCTTTGAACCAAG -3'

Sequencing Primer
(F):5'- ACACACATGCATAGTTAGGGC -3'
(R):5'- AGCAGCTGAACAGATGCA -3'

Posted On

2014-01-29