Incidental Mutation 'R1279:Olfr1564'
ID150988
Institutional Source Beutler Lab
Gene Symbol Olfr1564
Ensembl Gene ENSMUSG00000096169
Gene Nameolfactory receptor 1564
SynonymsGm4461
MMRRC Submission 039345-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R1279 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33211206-33221690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33216326 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 6 (Y6C)
Ref Sequence ENSEMBL: ENSMUSP00000150573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112162] [ENSMUST00000208645] [ENSMUST00000213642] [ENSMUST00000213751] [ENSMUST00000215450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112162
AA Change: Y9C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127247
Gene: ENSMUSG00000096169
AA Change: Y9C

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 3.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 263 1.5e-5 PFAM
Pfam:7tm_1 44 297 5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208645
AA Change: Y6C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213642
AA Change: Y6C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213751
AA Change: Y6C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215450
AA Change: Y6C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Atp6v0d2 A T 4: 19,878,298 M325K probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm10436 C T 12: 88,175,880 V323M probably benign Het
Gm17305 TCTCCTCCTCCTCCTCCTCCTC TCTCCTCCTCCTCCTCCTC 11: 69,369,349 probably benign Het
Mfap5 A G 6: 122,526,763 probably null Het
Nrcam T C 12: 44,544,877 probably null Het
Oas1a A G 5: 120,897,178 probably null Het
Oat A T 7: 132,567,080 L137H probably damaging Het
Olfr135 A G 17: 38,208,787 I181V probably benign Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Padi3 T C 4: 140,803,577 S45G probably benign Het
Pias1 A G 9: 62,892,145 S488P probably damaging Het
Plxnb2 G A 15: 89,162,321 T873I probably benign Het
Ppp4r2 A T 6: 100,865,918 R176* probably null Het
Prkdc A T 16: 15,690,282 L932F probably damaging Het
Ros1 C A 10: 52,142,166 A799S possibly damaging Het
Scn4a A T 11: 106,335,682 I684N probably damaging Het
Sypl2 A G 3: 108,217,674 F124L probably damaging Het
Tacr1 G T 6: 82,557,183 E397* probably null Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Vmn1r7 T C 6: 57,024,949 T109A possibly damaging Het
Zp1 A G 19: 10,918,577 S232P probably damaging Het
Other mutations in Olfr1564
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr1564 APN 17 33215973 missense probably benign 0.41
R0079:Olfr1564 UTSW 17 33216105 missense probably benign 0.14
R0939:Olfr1564 UTSW 17 33215661 missense possibly damaging 0.72
R2167:Olfr1564 UTSW 17 33215568 missense probably damaging 0.97
R2866:Olfr1564 UTSW 17 33216278 missense probably benign 0.22
R4738:Olfr1564 UTSW 17 33215810 missense probably benign 0.03
R4976:Olfr1564 UTSW 17 33215754 missense probably benign 0.35
R6452:Olfr1564 UTSW 17 33215945 missense probably benign 0.03
R6721:Olfr1564 UTSW 17 33215534 missense probably benign
R7322:Olfr1564 UTSW 17 33215699 missense probably damaging 1.00
R8032:Olfr1564 UTSW 17 33215950 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCATAGCCCATGACGGTGAGTAGAA -3'
(R):5'- TGCATGGTGGTGAGACCTGAGA -3'

Sequencing Primer
(F):5'- AGGTCAGCCAACATGCG -3'
(R):5'- CCTGAGAAAGTTAAAGAAGCCTC -3'
Posted On2014-01-29