Incidental Mutation 'R1280:Entpd2'
ID150991
Institutional Source Beutler Lab
Gene Symbol Entpd2
Ensembl Gene ENSMUSG00000015085
Gene Nameectonucleoside triphosphate diphosphohydrolase 2
SynonymsCd39l1, NTPDase2
MMRRC Submission 039346-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R1280 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25395874-25401321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25399484 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 326 (S326F)
Ref Sequence ENSEMBL: ENSMUSP00000028328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028328] [ENSMUST00000055921] [ENSMUST00000071442] [ENSMUST00000141567] [ENSMUST00000154809]
Predicted Effect probably damaging
Transcript: ENSMUST00000028328
AA Change: S326F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028328
Gene: ENSMUSG00000015085
AA Change: S326F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:GDA1_CD39 32 459 9.7e-104 PFAM
low complexity region 465 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055921
SMART Domains Protein: ENSMUSP00000049602
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 341 9.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071442
SMART Domains Protein: ENSMUSP00000071387
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 332 7.2e-217 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141106
Predicted Effect probably benign
Transcript: ENSMUST00000141567
SMART Domains Protein: ENSMUSP00000116275
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 231 7.8e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148859
Predicted Effect probably benign
Transcript: ENSMUST00000154809
SMART Domains Protein: ENSMUSP00000123386
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 142 1.8e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156824
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the type 2 enzyme of the ecto-nucleoside triphosphate diphosphohydrolase family (E-NTPDase). E-NTPDases are a family of ecto-nucleosidases that hydrolyze 5'-triphosphates. This ecto-ATPase is an integral membrane protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display smaller circumvallate papilla size and reduced neural responses to taste stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp5g3 G T 2: 73,909,370 T42K possibly damaging Het
Brd2 T C 17: 34,114,150 M60V possibly damaging Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Cers6 G A 2: 69,068,689 V224I probably benign Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Socs4 A T 14: 47,290,913 Q435L probably benign Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Tekt4 T A 17: 25,471,887 W56R probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Vps54 T A 11: 21,277,868 I273N possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Entpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Entpd2 APN 2 25398734 missense probably benign
IGL02869:Entpd2 APN 2 25398108 missense probably damaging 1.00
IGL03170:Entpd2 APN 2 25399481 missense probably damaging 1.00
R2258:Entpd2 UTSW 2 25398087 missense probably damaging 1.00
R2260:Entpd2 UTSW 2 25398087 missense probably damaging 1.00
R2420:Entpd2 UTSW 2 25399283 missense probably benign
R2566:Entpd2 UTSW 2 25399283 missense probably benign 0.16
R4802:Entpd2 UTSW 2 25399764 splice site probably null
R4938:Entpd2 UTSW 2 25399417 missense probably benign 0.25
R5239:Entpd2 UTSW 2 25400818 missense probably damaging 0.96
R5374:Entpd2 UTSW 2 25399726 missense probably damaging 1.00
R5739:Entpd2 UTSW 2 25399492 missense possibly damaging 0.90
R5752:Entpd2 UTSW 2 25399769 unclassified probably benign
R5881:Entpd2 UTSW 2 25400812 missense probably damaging 1.00
R6016:Entpd2 UTSW 2 25398556 missense probably damaging 0.99
R6120:Entpd2 UTSW 2 25399466 missense probably benign 0.03
R6370:Entpd2 UTSW 2 25397417 missense probably damaging 1.00
R7301:Entpd2 UTSW 2 25400909 missense possibly damaging 0.88
R8059:Entpd2 UTSW 2 25398084 missense probably damaging 0.98
R8257:Entpd2 UTSW 2 25398121 missense probably damaging 1.00
RF007:Entpd2 UTSW 2 25400895 frame shift probably null
RF017:Entpd2 UTSW 2 25400895 frame shift probably null
RF018:Entpd2 UTSW 2 25400895 frame shift probably null
RF023:Entpd2 UTSW 2 25400895 frame shift probably null
RF024:Entpd2 UTSW 2 25400895 frame shift probably null
X0009:Entpd2 UTSW 2 25398679 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTACGAACAGTTCATCAGGCTGC -3'
(R):5'- GGGGAAAGTGTCTTACCCAGATGTG -3'

Sequencing Primer
(F):5'- AGTGGGGAACTCTATCTGTACTC -3'
(R):5'- GTCTTACCCAGATGTGGAGAATATG -3'
Posted On2014-01-29