Incidental Mutation 'R1280:Entpd2'
ID 150991
Institutional Source Beutler Lab
Gene Symbol Entpd2
Ensembl Gene ENSMUSG00000015085
Gene Name ectonucleoside triphosphate diphosphohydrolase 2
Synonyms NTPDase2, Cd39l1
MMRRC Submission 039346-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R1280 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 25285886-25291333 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 25289496 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 326 (S326F)
Ref Sequence ENSEMBL: ENSMUSP00000028328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028328] [ENSMUST00000055921] [ENSMUST00000071442] [ENSMUST00000154809] [ENSMUST00000141567]
AlphaFold O55026
Predicted Effect probably damaging
Transcript: ENSMUST00000028328
AA Change: S326F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028328
Gene: ENSMUSG00000015085
AA Change: S326F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:GDA1_CD39 32 459 9.7e-104 PFAM
low complexity region 465 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055921
SMART Domains Protein: ENSMUSP00000049602
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 341 9.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071442
SMART Domains Protein: ENSMUSP00000071387
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 332 7.2e-217 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144413
Predicted Effect probably benign
Transcript: ENSMUST00000154809
SMART Domains Protein: ENSMUSP00000123386
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 142 1.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141567
SMART Domains Protein: ENSMUSP00000116275
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 231 7.8e-141 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the type 2 enzyme of the ecto-nucleoside triphosphate diphosphohydrolase family (E-NTPDase). E-NTPDases are a family of ecto-nucleosidases that hydrolyze 5'-triphosphates. This ecto-ATPase is an integral membrane protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display smaller circumvallate papilla size and reduced neural responses to taste stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Atp5mc3 G T 2: 73,739,714 (GRCm39) T42K possibly damaging Het
Brd2 T C 17: 34,333,124 (GRCm39) M60V possibly damaging Het
Cabp1 T C 5: 115,313,530 (GRCm39) N226S probably benign Het
Cers6 G A 2: 68,899,033 (GRCm39) V224I probably benign Het
Fez1 GACAAACA GACA 9: 36,781,845 (GRCm39) probably null Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Klhdc7a G A 4: 139,692,764 (GRCm39) R728C probably benign Het
Myo18b A G 5: 112,871,671 (GRCm39) probably null Het
Mzf1 A T 7: 12,787,010 (GRCm39) L20Q probably damaging Het
Neil1 T C 9: 57,054,185 (GRCm39) Y45C probably damaging Het
Or2ad1 C T 13: 21,326,337 (GRCm39) V297I probably benign Het
Rbm12 T C 2: 155,938,749 (GRCm39) K508E probably damaging Het
Socs4 A T 14: 47,528,370 (GRCm39) Q435L probably benign Het
Tdrd9 T C 12: 112,005,842 (GRCm39) V905A probably damaging Het
Tekt4 T A 17: 25,690,861 (GRCm39) W56R probably damaging Het
Ttn A T 2: 76,608,508 (GRCm39) I16059N possibly damaging Het
Ubqln3 A G 7: 103,791,283 (GRCm39) V269A possibly damaging Het
Vps54 T A 11: 21,227,868 (GRCm39) I273N possibly damaging Het
Zfp831 A G 2: 174,545,852 (GRCm39) K1319R probably benign Het
Other mutations in Entpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Entpd2 APN 2 25,288,746 (GRCm39) missense probably benign
IGL02869:Entpd2 APN 2 25,288,120 (GRCm39) missense probably damaging 1.00
IGL03170:Entpd2 APN 2 25,289,493 (GRCm39) missense probably damaging 1.00
R2258:Entpd2 UTSW 2 25,288,099 (GRCm39) missense probably damaging 1.00
R2260:Entpd2 UTSW 2 25,288,099 (GRCm39) missense probably damaging 1.00
R2420:Entpd2 UTSW 2 25,289,295 (GRCm39) missense probably benign
R2566:Entpd2 UTSW 2 25,289,295 (GRCm39) missense probably benign 0.16
R4802:Entpd2 UTSW 2 25,289,776 (GRCm39) splice site probably null
R4938:Entpd2 UTSW 2 25,289,429 (GRCm39) missense probably benign 0.25
R5239:Entpd2 UTSW 2 25,290,830 (GRCm39) missense probably damaging 0.96
R5374:Entpd2 UTSW 2 25,289,738 (GRCm39) missense probably damaging 1.00
R5739:Entpd2 UTSW 2 25,289,504 (GRCm39) missense possibly damaging 0.90
R5752:Entpd2 UTSW 2 25,289,781 (GRCm39) unclassified probably benign
R5881:Entpd2 UTSW 2 25,290,824 (GRCm39) missense probably damaging 1.00
R6016:Entpd2 UTSW 2 25,288,568 (GRCm39) missense probably damaging 0.99
R6120:Entpd2 UTSW 2 25,289,478 (GRCm39) missense probably benign 0.03
R6370:Entpd2 UTSW 2 25,287,429 (GRCm39) missense probably damaging 1.00
R7301:Entpd2 UTSW 2 25,290,921 (GRCm39) missense possibly damaging 0.88
R8059:Entpd2 UTSW 2 25,288,096 (GRCm39) missense probably damaging 0.98
R8257:Entpd2 UTSW 2 25,288,133 (GRCm39) missense probably damaging 1.00
R8868:Entpd2 UTSW 2 25,289,725 (GRCm39) missense probably benign 0.01
R9259:Entpd2 UTSW 2 25,288,614 (GRCm39) missense probably damaging 1.00
R9280:Entpd2 UTSW 2 25,289,511 (GRCm39) missense possibly damaging 0.55
R9660:Entpd2 UTSW 2 25,288,153 (GRCm39) missense probably damaging 1.00
RF007:Entpd2 UTSW 2 25,290,907 (GRCm39) frame shift probably null
RF017:Entpd2 UTSW 2 25,290,907 (GRCm39) frame shift probably null
RF018:Entpd2 UTSW 2 25,290,907 (GRCm39) frame shift probably null
RF023:Entpd2 UTSW 2 25,290,907 (GRCm39) frame shift probably null
RF024:Entpd2 UTSW 2 25,290,907 (GRCm39) frame shift probably null
X0009:Entpd2 UTSW 2 25,288,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTACGAACAGTTCATCAGGCTGC -3'
(R):5'- GGGGAAAGTGTCTTACCCAGATGTG -3'

Sequencing Primer
(F):5'- AGTGGGGAACTCTATCTGTACTC -3'
(R):5'- GTCTTACCCAGATGTGGAGAATATG -3'
Posted On 2014-01-29