Incidental Mutation 'R1280:Cers6'
ID150992
Institutional Source Beutler Lab
Gene Symbol Cers6
Ensembl Gene ENSMUSG00000027035
Gene Nameceramide synthase 6
Synonymssimilar to TRH1, Lass6, CerS6, T1L, 4732462C07Rik
MMRRC Submission 039346-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R1280 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location68861441-69114282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69068689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 224 (V224I)
Ref Sequence ENSEMBL: ENSMUSP00000028426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028426] [ENSMUST00000176018]
PDB Structure
Solution structure of the homeobox domain of mouse LAG1 longevity assurance homolog 6 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000028426
AA Change: V224I

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028426
Gene: ENSMUSG00000027035
AA Change: V224I

DomainStartEndE-ValueType
Blast:TLC 10 57 6e-7 BLAST
HOX 73 131 2.92e-2 SMART
TLC 130 331 1.21e-74 SMART
low complexity region 336 353 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175684
Predicted Effect probably benign
Transcript: ENSMUST00000176018
AA Change: V224I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135604
Gene: ENSMUSG00000027035
AA Change: V224I

DomainStartEndE-ValueType
Blast:TLC 10 57 7e-7 BLAST
HOX 73 131 2.92e-2 SMART
TLC 130 331 1.21e-74 SMART
low complexity region 344 361 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit hind limb clasping, habituation deficit and altered lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp5g3 G T 2: 73,909,370 T42K possibly damaging Het
Brd2 T C 17: 34,114,150 M60V possibly damaging Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Entpd2 C T 2: 25,399,484 S326F probably damaging Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Socs4 A T 14: 47,290,913 Q435L probably benign Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Tekt4 T A 17: 25,471,887 W56R probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Vps54 T A 11: 21,277,868 I273N possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Cers6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02513:Cers6 APN 2 69068669 missense probably benign
IGL02897:Cers6 APN 2 68934533 nonsense probably null
IGL03299:Cers6 APN 2 68861784 missense probably benign 0.17
R0520:Cers6 UTSW 2 69105091 nonsense probably null
R2497:Cers6 UTSW 2 69071446 splice site probably benign
R4843:Cers6 UTSW 2 69068659 missense probably benign 0.03
R4931:Cers6 UTSW 2 69105112 missense probably damaging 0.98
R5723:Cers6 UTSW 2 69108445 missense probably benign 0.03
R5973:Cers6 UTSW 2 69068625 splice site probably null
R6058:Cers6 UTSW 2 68861664 missense probably benign 0.12
R6453:Cers6 UTSW 2 69047169 missense probably benign 0.00
R6788:Cers6 UTSW 2 69108559 missense possibly damaging 0.95
R7493:Cers6 UTSW 2 68861807 critical splice donor site probably null
R8055:Cers6 UTSW 2 68947281 missense probably damaging 1.00
R8364:Cers6 UTSW 2 68861739 missense possibly damaging 0.50
R8399:Cers6 UTSW 2 68861771 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGGAAATCCCAATTGTGCAGGAG -3'
(R):5'- GATGCTAACAAAGCTCACTTTGGACAC -3'

Sequencing Primer
(F):5'- tcacctgcctctgcctc -3'
(R):5'- CTTTGGACACACATTTGCATGG -3'
Posted On2014-01-29