Incidental Mutation 'R1280:Atp5g3'
ID150993
Institutional Source Beutler Lab
Gene Symbol Atp5g3
Ensembl Gene ENSMUSG00000018770
Gene NameATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9)
Synonyms
MMRRC Submission 039346-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R1280 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location73908447-73911326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73909370 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 42 (T42K)
Ref Sequence ENSEMBL: ENSMUSP00000107627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018914] [ENSMUST00000111996]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018914
AA Change: T42K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018914
Gene: ENSMUSG00000018770
AA Change: T42K

DomainStartEndE-ValueType
Pfam:ATP-synt_C 73 138 7.9e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111996
AA Change: T42K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107627
Gene: ENSMUSG00000018770
AA Change: T42K

DomainStartEndE-ValueType
Pfam:ATP-synt_C 72 140 2.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155474
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of mitochondrial membrane ATP synthase, the enzyme that catalyzes ATP synthesis during oxidative phosphorylation. This gene encodes subunit 9, which is present in multiple copies in the transmembrane part of the ATP synthase complex. Phenotype and gene expression profiles suggest correlations between this gene and alcoholism- and obesity-related phenotypes. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Brd2 T C 17: 34,114,150 M60V possibly damaging Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Cers6 G A 2: 69,068,689 V224I probably benign Het
Entpd2 C T 2: 25,399,484 S326F probably damaging Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Socs4 A T 14: 47,290,913 Q435L probably benign Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Tekt4 T A 17: 25,471,887 W56R probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Vps54 T A 11: 21,277,868 I273N possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Atp5g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Atp5g3 APN 2 73909926 nonsense probably null
IGL01125:Atp5g3 APN 2 73910949 splice site probably benign
IGL01945:Atp5g3 APN 2 73910969 missense probably benign
R4254:Atp5g3 UTSW 2 73909975 intron probably benign
R5713:Atp5g3 UTSW 2 73909307 missense probably benign
R6782:Atp5g3 UTSW 2 73909328 missense probably benign
R7939:Atp5g3 UTSW 2 73909862 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCAAAGACTGTTCCAATACCAGC -3'
(R):5'- GGCCAGCACAACCTTCTGAATTAGC -3'

Sequencing Primer
(F):5'- TGTTCCAATACCAGCACCAG -3'
(R):5'- CCAAAAAAGCCTGCTTTGTTG -3'
Posted On2014-01-29