Incidental Mutation 'R1280:Gjb3'
ID150997
Institutional Source Beutler Lab
Gene Symbol Gjb3
Ensembl Gene ENSMUSG00000042367
Gene Namegap junction protein, beta 3
SynonymsD4Wsu144e, Gjb-3, Cx31, connexin 31, Cnx31
MMRRC Submission 039346-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1280 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127325235-127330844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127326431 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 103 (R103W)
Ref Sequence ENSEMBL: ENSMUSP00000101697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046532] [ENSMUST00000106091]
Predicted Effect probably damaging
Transcript: ENSMUST00000046532
AA Change: R103W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046755
Gene: ENSMUSG00000042367
AA Change: R103W

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 3.47e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 209 3.05e-33 SMART
low complexity region 219 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106091
AA Change: R103W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101697
Gene: ENSMUSG00000042367
AA Change: R103W

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 3.47e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 209 3.05e-33 SMART
low complexity region 219 237 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene can cause non-syndromic deafness or erythrokeratodermia variabilis, a skin disorder. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit partial lethality and transient placental dysmorphogenesis but no impairment in hearing or skin differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp5g3 G T 2: 73,909,370 T42K possibly damaging Het
Brd2 T C 17: 34,114,150 M60V possibly damaging Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Cers6 G A 2: 69,068,689 V224I probably benign Het
Entpd2 C T 2: 25,399,484 S326F probably damaging Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Socs4 A T 14: 47,290,913 Q435L probably benign Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Tekt4 T A 17: 25,471,887 W56R probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Vps54 T A 11: 21,277,868 I273N possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Gjb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Gjb3 APN 4 127326121 missense probably damaging 0.99
IGL02398:Gjb3 APN 4 127326062 missense probably benign 0.00
IGL02501:Gjb3 APN 4 127326364 missense probably damaging 1.00
IGL02680:Gjb3 APN 4 127326022 missense probably damaging 0.98
R0118:Gjb3 UTSW 4 127326658 missense probably damaging 1.00
R0481:Gjb3 UTSW 4 127326332 missense probably benign 0.00
R1142:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1250:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1279:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1281:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1282:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1322:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1324:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1325:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1341:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1382:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1799:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1834:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1836:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R4650:Gjb3 UTSW 4 127326691 missense probably damaging 1.00
R5026:Gjb3 UTSW 4 127326487 missense probably damaging 1.00
R6310:Gjb3 UTSW 4 127326640 missense probably damaging 0.99
R6357:Gjb3 UTSW 4 127326630 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTAGCAATCCACGGTGTTGGGG -3'
(R):5'- CGCATCTGGCTGTCAGTAGTGTTC -3'

Sequencing Primer
(F):5'- TGGCGCACTGTACCAGAC -3'
(R):5'- TCAGTAGTGTTCGTCTTCCG -3'
Posted On2014-01-29