Incidental Mutation 'R1280:Klhdc7a'
ID150998
Institutional Source Beutler Lab
Gene Symbol Klhdc7a
Ensembl Gene ENSMUSG00000078234
Gene Namekelch domain containing 7A
Synonyms
MMRRC Submission 039346-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1280 (G1)
Quality Score188
Status Not validated
Chromosome4
Chromosomal Location139960220-139968026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139965453 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 728 (R728C)
Ref Sequence ENSEMBL: ENSMUSP00000100648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105031]
Predicted Effect probably benign
Transcript: ENSMUST00000105031
AA Change: R728C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000100648
Gene: ENSMUSG00000078234
AA Change: R728C

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 81 93 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Kelch 537 585 4.83e-2 SMART
Kelch 586 631 4.98e-4 SMART
low complexity region 756 769 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158669
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp5g3 G T 2: 73,909,370 T42K possibly damaging Het
Brd2 T C 17: 34,114,150 M60V possibly damaging Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Cers6 G A 2: 69,068,689 V224I probably benign Het
Entpd2 C T 2: 25,399,484 S326F probably damaging Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Socs4 A T 14: 47,290,913 Q435L probably benign Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Tekt4 T A 17: 25,471,887 W56R probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Vps54 T A 11: 21,277,868 I273N possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Klhdc7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Klhdc7a APN 4 139966925 missense probably benign 0.00
IGL01588:Klhdc7a APN 4 139966946 missense probably damaging 0.98
IGL01593:Klhdc7a APN 4 139966814 missense probably damaging 1.00
IGL01719:Klhdc7a APN 4 139966550 missense probably damaging 1.00
IGL02333:Klhdc7a APN 4 139967156 missense probably benign 0.07
IGL02481:Klhdc7a APN 4 139965810 missense probably benign 0.25
R0153:Klhdc7a UTSW 4 139967271 missense possibly damaging 0.83
R0385:Klhdc7a UTSW 4 139966705 missense probably benign
R1456:Klhdc7a UTSW 4 139965524 missense possibly damaging 0.46
R1837:Klhdc7a UTSW 4 139967070 missense probably benign 0.31
R1838:Klhdc7a UTSW 4 139967070 missense probably benign 0.31
R1987:Klhdc7a UTSW 4 139966024 nonsense probably null
R2172:Klhdc7a UTSW 4 139965810 missense probably benign 0.25
R2220:Klhdc7a UTSW 4 139965453 missense probably benign 0.01
R3154:Klhdc7a UTSW 4 139965713 missense probably benign 0.20
R3155:Klhdc7a UTSW 4 139967189 missense probably benign 0.01
R4242:Klhdc7a UTSW 4 139966721 missense probably benign 0.01
R4349:Klhdc7a UTSW 4 139966277 missense possibly damaging 0.67
R5859:Klhdc7a UTSW 4 139967574 missense probably damaging 0.96
R6316:Klhdc7a UTSW 4 139966802 missense probably benign 0.00
R6342:Klhdc7a UTSW 4 139967059 missense probably benign 0.09
R6755:Klhdc7a UTSW 4 139966475 missense possibly damaging 0.80
R7528:Klhdc7a UTSW 4 139967517 missense probably damaging 1.00
R7648:Klhdc7a UTSW 4 139965939 missense possibly damaging 0.66
R7842:Klhdc7a UTSW 4 139967238 missense probably damaging 0.97
R7843:Klhdc7a UTSW 4 139966844 missense possibly damaging 0.87
R7925:Klhdc7a UTSW 4 139967238 missense probably damaging 0.97
R7926:Klhdc7a UTSW 4 139966844 missense possibly damaging 0.87
X0002:Klhdc7a UTSW 4 139966364 small deletion probably benign
Z1176:Klhdc7a UTSW 4 139967797
Z1177:Klhdc7a UTSW 4 139965662 missense not run
Z1177:Klhdc7a UTSW 4 139967000 missense not run
Predicted Primers PCR Primer
(F):5'- TTCTGAATCCTGATGGAGCCCAGC -3'
(R):5'- CGATACATTTGCCCTGGCACACAC -3'

Sequencing Primer
(F):5'- AGCTGAGGGACTGCTAGAC -3'
(R):5'- GATTCTCGACCCAGGAACAG -3'
Posted On2014-01-29