Incidental Mutation 'R1280:Cabp1'
ID151001
Institutional Source Beutler Lab
Gene Symbol Cabp1
Ensembl Gene ENSMUSG00000029544
Gene Namecalcium binding protein 1
Synonyms
MMRRC Submission 039346-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1280 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115168689-115194381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115175471 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 226 (N226S)
Ref Sequence ENSEMBL: ENSMUSP00000107741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031519] [ENSMUST00000112112] [ENSMUST00000112113] [ENSMUST00000145197]
Predicted Effect probably benign
Transcript: ENSMUST00000031519
AA Change: N103S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031519
Gene: ENSMUSG00000029544
AA Change: N103S

DomainStartEndE-ValueType
EFh 86 114 1.22e-5 SMART
Blast:EFh 122 150 1e-7 BLAST
EFh 163 191 3.93e-9 SMART
EFh 200 227 7.82e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112109
SMART Domains Protein: ENSMUSP00000107737
Gene: ENSMUSG00000029544

DomainStartEndE-ValueType
EFh 71 99 1.22e-5 SMART
Blast:EFh 107 135 8e-8 BLAST
EFh 148 176 3.93e-9 SMART
EFh 185 212 7.82e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112112
AA Change: N43S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107740
Gene: ENSMUSG00000029544
AA Change: N43S

DomainStartEndE-ValueType
EFh 26 54 1.22e-5 SMART
Blast:EFh 62 90 5e-8 BLAST
EFh 103 131 3.93e-9 SMART
EFh 140 167 7.82e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112113
AA Change: N226S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107741
Gene: ENSMUSG00000029544
AA Change: N226S

DomainStartEndE-ValueType
low complexity region 29 55 N/A INTRINSIC
low complexity region 58 113 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
EFh 209 237 1.22e-5 SMART
Blast:EFh 245 273 3e-7 BLAST
EFh 286 314 3.93e-9 SMART
EFh 323 350 7.82e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201900
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele are viable and fertile and show no apparent motor deficits, but they are affected in the transmission of responses to light through the retinal circuits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp5g3 G T 2: 73,909,370 T42K possibly damaging Het
Brd2 T C 17: 34,114,150 M60V possibly damaging Het
Cers6 G A 2: 69,068,689 V224I probably benign Het
Entpd2 C T 2: 25,399,484 S326F probably damaging Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Socs4 A T 14: 47,290,913 Q435L probably benign Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Tekt4 T A 17: 25,471,887 W56R probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Vps54 T A 11: 21,277,868 I273N possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Cabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1307:Cabp1 UTSW 5 115172906 missense probably damaging 0.99
R1435:Cabp1 UTSW 5 115173208 missense probably damaging 1.00
R2509:Cabp1 UTSW 5 115172784 missense probably damaging 1.00
R4417:Cabp1 UTSW 5 115186037 missense possibly damaging 0.68
R4788:Cabp1 UTSW 5 115175471 missense probably benign 0.06
R4837:Cabp1 UTSW 5 115173153 missense probably damaging 1.00
R5026:Cabp1 UTSW 5 115175472 missense possibly damaging 0.83
R5199:Cabp1 UTSW 5 115186043 missense possibly damaging 0.92
R6513:Cabp1 UTSW 5 115169134 missense possibly damaging 0.51
R6941:Cabp1 UTSW 5 115172901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGAAAAGACAAGCGGGTTTGTG -3'
(R):5'- GTTCACTTGGAACAGTCCCTAGCAC -3'

Sequencing Primer
(F):5'- tgtcgggaaacacagaacac -3'
(R):5'- CAGGGATCATTTTGTAGAGAGCC -3'
Posted On2014-01-29