Mutagenetix > Incidental Mutations

Incidental Mutation 'R1280:Fez1'

151005

Institutional Source

Beutler Lab

Gene Symbol

Fez1

Ensembl Gene

ENSMUSG00000032118

Gene Name

fasciculation and elongation protein zeta 1 (zygin I)

Synonyms

UNC-76, UNC76

MMRRC Submission

039346-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1280 (G1)

Quality Score

138

Status

Not validated

Chromosome

Chromosomal Location

36821864-36878924 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GACAAACA to GACA at 36870549 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034630] [ENSMUST00000162235] [ENSMUST00000163816]

Predicted Effect

probably null
Transcript: ENSMUST00000034630

SMART Domains

Protein: ENSMUSP00000034630
Gene: ENSMUSG00000032118

Domain	Start	End	E-Value	Type
Pfam:FEZ	58	300	3.4e-96	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159137

Predicted Effect

probably benign
Transcript: ENSMUST00000160041

SMART Domains

Protein: ENSMUSP00000124648
Gene: ENSMUSG00000032118

Domain	Start	End	E-Value	Type
Pfam:FEZ	35	87	4.6e-19	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000161978

Predicted Effect

probably null
Transcript: ENSMUST00000162235

Predicted Effect

probably null
Transcript: ENSMUST00000163816

SMART Domains

Protein: ENSMUSP00000126072
Gene: ENSMUSG00000032118

Domain	Start	End	E-Value	Type
Pfam:FEZ	58	297	2.7e-86	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216539

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.1%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Expression of this gene in C. elegans unc-76 mutants can restore to the mutants partial locomotion and axonal fasciculation, suggesting that it also functions in axonal outgrowth. The N-terminal half of the gene product is highly acidic. Alternatively spliced transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity and increased sensitivity to methamphetamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Atp5g3	G	T	2: 73,909,370	T42K	possibly damaging	Het
Brd2	T	C	17: 34,114,150	M60V	possibly damaging	Het
Cabp1	T	C	5: 115,175,471	N226S	probably benign	Het
Cers6	G	A	2: 69,068,689	V224I	probably benign	Het
Entpd2	C	T	2: 25,399,484	S326F	probably damaging	Het
Gjb3	G	A	4: 127,326,431	R103W	probably damaging	Het
Klhdc7a	G	A	4: 139,965,453	R728C	probably benign	Het
Myo18b	A	G	5: 112,723,805		probably null	Het
Mzf1	A	T	7: 13,053,083	L20Q	probably damaging	Het
Neil1	T	C	9: 57,146,901	Y45C	probably damaging	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Rbm12	T	C	2: 156,096,829	K508E	probably damaging	Het
Socs4	A	T	14: 47,290,913	Q435L	probably benign	Het
Tdrd9	T	C	12: 112,039,408	V905A	probably damaging	Het
Tekt4	T	A	17: 25,471,887	W56R	probably damaging	Het
Ttn	A	T	2: 76,778,164	I16059N	possibly damaging	Het
Ubqln3	A	G	7: 104,142,076	V269A	possibly damaging	Het
Vps54	T	A	11: 21,277,868	I273N	possibly damaging	Het
Zfp831	A	G	2: 174,704,059	K1319R	probably benign	Het

Other mutations in Fez1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02540:Fez1	APN	9	36850399	missense	probably damaging	0.97
R1458:Fez1	UTSW	9	36870549	frame shift	probably null
R1741:Fez1	UTSW	9	36843733	missense	probably damaging	1.00
R1846:Fez1	UTSW	9	36867767	missense	probably damaging	1.00
R2072:Fez1	UTSW	9	36867945	missense	probably benign	0.00
R4193:Fez1	UTSW	9	36843727	missense	probably damaging	1.00
R4214:Fez1	UTSW	9	36870488	missense	probably damaging	0.99
R4417:Fez1	UTSW	9	36870472	splice site	probably benign
R4696:Fez1	UTSW	9	36870470	splice site	probably null
R4735:Fez1	UTSW	9	36860845	nonsense	probably null
R4947:Fez1	UTSW	9	36868875	missense	probably damaging	0.99
R4950:Fez1	UTSW	9	36867882	missense	probably damaging	1.00
R5538:Fez1	UTSW	9	36868876	missense	probably damaging	1.00
R5618:Fez1	UTSW	9	36843932	missense	probably damaging	1.00
R5742:Fez1	UTSW	9	36850447	critical splice donor site	probably null
R7089:Fez1	UTSW	9	36867703	missense	probably benign	0.00
R7250:Fez1	UTSW	9	36867794	missense	probably damaging	1.00
R7387:Fez1	UTSW	9	36867812	missense	probably damaging	1.00
R7653:Fez1	UTSW	9	36860850	missense	probably benign	0.38
R7662:Fez1	UTSW	9	36870500	missense	probably damaging	1.00
R7974:Fez1	UTSW	9	36843948	missense	probably damaging	1.00
R8341:Fez1	UTSW	9	36876309	missense	possibly damaging	0.94
Z1177:Fez1	UTSW	9	36867759	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACTGCCCCAGCTATCATTCAGGAG -3'
(R):5'- TCTTGCCCCATGCAAAGCCATC -3'

Sequencing Primer
(F):5'- GTTTCCCCCATTGATACAGGAAAG -3'
(R):5'- GCCATCCTAAAGAAATCTGGAAACTG -3'

Posted On

2014-01-29