Incidental Mutation 'R1280:Socs4'
ID151010
Institutional Source Beutler Lab
Gene Symbol Socs4
Ensembl Gene ENSMUSG00000048379
Gene Namesuppressor of cytokine signaling 4
SynonymsSocs7
MMRRC Submission 039346-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R1280 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47276931-47296102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47290913 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 435 (Q435L)
Ref Sequence ENSEMBL: ENSMUSP00000066031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065562] [ENSMUST00000227413]
Predicted Effect probably benign
Transcript: ENSMUST00000065562
AA Change: Q435L

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000066031
Gene: ENSMUSG00000048379
AA Change: Q435L

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
Pfam:SOCS 55 108 6.8e-23 PFAM
low complexity region 219 232 N/A INTRINSIC
SH2 281 367 1.11e-16 SMART
SOCS 377 420 1.69e-16 SMART
SOCS_box 383 419 1.13e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227413
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS), also known as STAT-induced STAT inhibitor (SSI), protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp5g3 G T 2: 73,909,370 T42K possibly damaging Het
Brd2 T C 17: 34,114,150 M60V possibly damaging Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Cers6 G A 2: 69,068,689 V224I probably benign Het
Entpd2 C T 2: 25,399,484 S326F probably damaging Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Tekt4 T A 17: 25,471,887 W56R probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Vps54 T A 11: 21,277,868 I273N possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Socs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Socs4 APN 14 47290252 missense probably benign
IGL01942:Socs4 APN 14 47290650 nonsense probably null
IGL02039:Socs4 APN 14 47290193 missense probably benign
IGL02117:Socs4 APN 14 47290807 missense probably damaging 1.00
R0281:Socs4 UTSW 14 47289868 missense probably benign 0.25
R0703:Socs4 UTSW 14 47290048 missense probably damaging 1.00
R0763:Socs4 UTSW 14 47290655 missense probably damaging 1.00
R0842:Socs4 UTSW 14 47289969 missense probably damaging 0.98
R1133:Socs4 UTSW 14 47290194 missense probably benign 0.01
R1619:Socs4 UTSW 14 47290283 missense possibly damaging 0.87
R1632:Socs4 UTSW 14 47289577 start gained probably benign
R5058:Socs4 UTSW 14 47290132 nonsense probably null
R6008:Socs4 UTSW 14 47290161 missense probably damaging 0.98
R6648:Socs4 UTSW 14 47290176 missense probably benign 0.02
R6925:Socs4 UTSW 14 47289738 nonsense probably null
R7408:Socs4 UTSW 14 47289839 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGTGCCTGTATGTTCTTTGAGCC -3'
(R):5'- GCCTTGAAATTGTAAATATGCCTGGACC -3'

Sequencing Primer
(F):5'- GAGCCGCTCTTGTCCAC -3'
(R):5'- TGGTAAAAACAAAACCAAACACCTG -3'
Posted On2014-01-29