Incidental Mutation 'R1280:Tekt4'
ID151011
Institutional Source Beutler Lab
Gene Symbol Tekt4
Ensembl Gene ENSMUSG00000024175
Gene Nametektin 4
Synonyms
MMRRC Submission 039346-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1280 (G1)
Quality Score203
Status Not validated
Chromosome17
Chromosomal Location25471590-25476594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25471887 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 56 (W56R)
Ref Sequence ENSEMBL: ENSMUSP00000025002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025002]
Predicted Effect probably damaging
Transcript: ENSMUST00000025002
AA Change: W56R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025002
Gene: ENSMUSG00000024175
AA Change: W56R

DomainStartEndE-ValueType
Pfam:Tektin 56 438 6.2e-143 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased male fertility due to abnormal flagellum function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp5g3 G T 2: 73,909,370 T42K possibly damaging Het
Brd2 T C 17: 34,114,150 M60V possibly damaging Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Cers6 G A 2: 69,068,689 V224I probably benign Het
Entpd2 C T 2: 25,399,484 S326F probably damaging Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Socs4 A T 14: 47,290,913 Q435L probably benign Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Vps54 T A 11: 21,277,868 I273N possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Tekt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Tekt4 APN 17 25476384 missense probably benign 0.31
IGL02657:Tekt4 APN 17 25473758 missense possibly damaging 0.93
R0788:Tekt4 UTSW 17 25472047 missense probably damaging 1.00
R1466:Tekt4 UTSW 17 25472074 missense probably benign 0.29
R1466:Tekt4 UTSW 17 25472074 missense probably benign 0.29
R1819:Tekt4 UTSW 17 25473811 splice site probably null
R1902:Tekt4 UTSW 17 25471858 missense possibly damaging 0.63
R2262:Tekt4 UTSW 17 25476511 missense possibly damaging 0.76
R2263:Tekt4 UTSW 17 25476511 missense possibly damaging 0.76
R4010:Tekt4 UTSW 17 25476486 missense probably damaging 1.00
R4604:Tekt4 UTSW 17 25471775 missense probably benign
R5085:Tekt4 UTSW 17 25473775 missense probably damaging 0.99
R6187:Tekt4 UTSW 17 25472223 missense probably damaging 1.00
R7102:Tekt4 UTSW 17 25474744 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACCTTGCTTGGGACAGAGTGAC -3'
(R):5'- TGCAGCTCTGACTTCCAGCAATG -3'

Sequencing Primer
(F):5'- TGGACAATTGCCCAGTGAC -3'
(R):5'- GACTTCCAGCAATGCATGTC -3'
Posted On2014-01-29