Incidental Mutation 'R1280:Brd2'
ID151012
Institutional Source Beutler Lab
Gene Symbol Brd2
Ensembl Gene ENSMUSG00000024335
Gene Namebromodomain containing 2
SynonymsFrg-1, Fsrg1, D17H6S113E, Ring3, Rnf3
MMRRC Submission 039346-MU
Accession Numbers

Genbank: NM_010238, NM_001025387; MGI: 99495

 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1280 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34112023-34122634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34114150 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 60 (M60V)
Ref Sequence ENSEMBL: ENSMUSP00000092990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025193] [ENSMUST00000095347] [ENSMUST00000114242] [ENSMUST00000151986] [ENSMUST00000154232]
Predicted Effect probably benign
Transcript: ENSMUST00000025193
AA Change: M452V

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025193
Gene: ENSMUSG00000024335
AA Change: M452V

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
coiled coil region 486 537 N/A INTRINSIC
low complexity region 542 560 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
PDB:2JNS|A 635 712 3e-37 PDB
coiled coil region 721 750 N/A INTRINSIC
low complexity region 772 797 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095347
AA Change: M60V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092990
Gene: ENSMUSG00000024335
AA Change: M60V

DomainStartEndE-ValueType
BROMO 25 135 1.3e-45 SMART
low complexity region 210 230 N/A INTRINSIC
low complexity region 238 244 N/A INTRINSIC
low complexity region 248 258 N/A INTRINSIC
BROMO 299 408 6.8e-50 SMART
coiled coil region 440 491 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
PDB:2JNS|A 589 666 2e-37 PDB
coiled coil region 675 704 N/A INTRINSIC
low complexity region 726 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114242
AA Change: M452V

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109880
Gene: ENSMUSG00000024335
AA Change: M452V

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
coiled coil region 486 537 N/A INTRINSIC
low complexity region 542 560 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
Pfam:BET 639 703 7.4e-35 PFAM
coiled coil region 721 750 N/A INTRINSIC
low complexity region 772 797 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148143
Predicted Effect possibly damaging
Transcript: ENSMUST00000151986
AA Change: M452V

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117359
Gene: ENSMUSG00000024335
AA Change: M452V

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154232
SMART Domains Protein: ENSMUSP00000128835
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 50 71 N/A INTRINSIC
Blast:BROMO 72 110 4e-21 BLAST
PDB:3AQA|C 72 110 2e-22 PDB
SCOP:d1f68a_ 76 103 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155286
Predicted Effect unknown
Transcript: ENSMUST00000173032
AA Change: M39V
SMART Domains Protein: ENSMUSP00000134608
Gene: ENSMUSG00000024335
AA Change: M39V

DomainStartEndE-ValueType
Pfam:Bromodomain 1 43 1.4e-6 PFAM
coiled coil region 73 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173204
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with decreased embryo size, decreased cell proliferation, a delay in the cell cycle, and increased cell death. Heterozygous mice also display decreased cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, other(2) Gene trapped(14)

Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp5g3 G T 2: 73,909,370 T42K possibly damaging Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Cers6 G A 2: 69,068,689 V224I probably benign Het
Entpd2 C T 2: 25,399,484 S326F probably damaging Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Socs4 A T 14: 47,290,913 Q435L probably benign Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Tekt4 T A 17: 25,471,887 W56R probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Vps54 T A 11: 21,277,868 I273N possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Brd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Brd2 APN 17 34114423 missense probably damaging 1.00
IGL01589:Brd2 APN 17 34117042 missense probably damaging 1.00
IGL01724:Brd2 APN 17 34117002 missense probably damaging 1.00
IGL01724:Brd2 APN 17 34117001 missense probably damaging 1.00
IGL02043:Brd2 APN 17 34112616 unclassified probably benign
crater UTSW 17 34113259 missense probably damaging 0.96
FR4449:Brd2 UTSW 17 34116336 unclassified probably benign
FR4548:Brd2 UTSW 17 34116336 unclassified probably benign
R0085:Brd2 UTSW 17 34113259 missense probably damaging 0.96
R0497:Brd2 UTSW 17 34114360 missense probably damaging 1.00
R0879:Brd2 UTSW 17 34113446 missense probably benign 0.03
R1150:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R1152:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R1426:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R2247:Brd2 UTSW 17 34114415 missense probably damaging 1.00
R3737:Brd2 UTSW 17 34117080 missense probably benign 0.10
R5286:Brd2 UTSW 17 34115231 missense probably damaging 0.97
R5673:Brd2 UTSW 17 34112607 unclassified probably benign
R6134:Brd2 UTSW 17 34113695 missense probably benign 0.00
R6318:Brd2 UTSW 17 34112898 missense probably damaging 1.00
R7257:Brd2 UTSW 17 34113822 missense probably damaging 1.00
R7493:Brd2 UTSW 17 34122257 unclassified probably benign
R7888:Brd2 UTSW 17 34117021 missense probably damaging 1.00
R7975:Brd2 UTSW 17 34115450 missense probably damaging 0.98
Z1176:Brd2 UTSW 17 34113688 missense possibly damaging 0.94
Z1177:Brd2 UTSW 17 34116907 critical splice donor site probably null
Z1177:Brd2 UTSW 17 34116908 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AACACAATGATCTACCTGCTCCTGC -3'
(R):5'- TGTACGGCTTATGTTCTCCAACTGC -3'

Sequencing Primer
(F):5'- TAGGCGATGAGCCCTTTCC -3'
(R):5'- GTTGAATTTACTCCACAGTAACTGCC -3'
Posted On2014-01-29