Mutagenetix > Incidental Mutation

Incidental Mutation 'R1281:Mroh2a'

151013

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804

MMRRC Submission

039347-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R1281 (G1)

Quality Score

153

Status

Not validated

Chromosome

Chromosomal Location

88154713-88190011 bp(+) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

T to TN at 88183889 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130] [ENSMUST00000135948]

AlphaFold

D3Z750

Predicted Effect

probably null
Transcript: ENSMUST00000061013

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113130

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135948

SMART Domains

Protein: ENSMUSP00000118971
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	15	174	5e-6	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aim2	A	T	1: 173,287,377 (GRCm39)	K126*	probably null	Het
C9	A	T	15: 6,519,321 (GRCm39)	N386I	possibly damaging	Het
Csnk1e	A	C	15: 79,304,841 (GRCm39)	N387K	possibly damaging	Het
Cul9	T	C	17: 46,822,460 (GRCm39)	T1758A	probably damaging	Het
Dcaf17	A	G	2: 70,908,500 (GRCm39)	I256V	probably damaging	Het
Duox1	G	A	2: 122,157,569 (GRCm39)	C565Y	probably damaging	Het
Fchsd2	A	G	7: 100,902,759 (GRCm39)	H379R	possibly damaging	Het
Gjb3	G	A	4: 127,220,224 (GRCm39)	R103W	probably damaging	Het
Krt1c	C	A	15: 101,721,727 (GRCm39)	C438F	probably damaging	Het
Mast4	G	A	13: 102,887,086 (GRCm39)	T1001I	probably damaging	Het
Mrc1	T	C	2: 14,298,321 (GRCm39)	F726L	probably damaging	Het
Mttp	T	C	3: 137,812,980 (GRCm39)	N550S	possibly damaging	Het
Necap1	G	T	6: 122,851,573 (GRCm39)	D16Y	possibly damaging	Het
Nox3	A	T	17: 3,746,460 (GRCm39)	I26N	probably damaging	Het
Patj	T	C	4: 98,304,932 (GRCm39)	I262T	probably damaging	Het
Pcdh8	T	C	14: 80,005,166 (GRCm39)	E953G	probably damaging	Het
Pirb	A	T	7: 3,720,189 (GRCm39)	C395S	probably damaging	Het
Sacs	A	G	14: 61,429,250 (GRCm39)	I433M	probably benign	Het
Sclt1	A	G	3: 41,602,055 (GRCm39)	F552L	probably benign	Het
Smc5	T	C	19: 23,213,247 (GRCm39)	N479S	probably benign	Het
Tg	G	A	15: 66,568,338 (GRCm39)	V1342I	probably benign	Het
Ube2n	C	A	10: 95,377,618 (GRCm39)	N132K	probably benign	Het
Vmn2r55	A	T	7: 12,404,825 (GRCm39)	C193S	probably benign	Het
Zc3hav1	A	G	6: 38,330,872 (GRCm39)	C96R	probably damaging	Het
Zfp60	T	A	7: 27,437,852 (GRCm39)	V53E	probably damaging	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88,172,692 (GRCm39)	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88,161,842 (GRCm39)	missense	possibly damaging	0.76
IGL00990:Mroh2a	APN	1	88,158,468 (GRCm39)	missense	probably damaging	0.99
IGL03097:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0068:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0139:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0374:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0583:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0613:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0657:Mroh2a	UTSW	1	88,183,287 (GRCm39)	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0659:Mroh2a	UTSW	1	88,178,064 (GRCm39)	missense	probably damaging	1.00
R0671:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88,156,102 (GRCm39)	missense	probably damaging	0.99
R0675:Mroh2a	UTSW	1	88,178,064 (GRCm39)	missense	probably damaging	1.00
R0689:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0689:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0735:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0845:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R0960:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1004:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1414:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88,169,353 (GRCm39)	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88,160,075 (GRCm39)	splice site	probably benign
R1442:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1686:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R1780:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1846:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R1899:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88,165,213 (GRCm39)	nonsense	probably null
R2122:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R2869:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R2870:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R2871:Mroh2a	UTSW	1	88,183,287 (GRCm39)	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3408:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3608:Mroh2a	UTSW	1	88,172,717 (GRCm39)	missense	probably damaging	1.00
R3730:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3937:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4022:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88,187,311 (GRCm39)	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R4701:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R4771:Mroh2a	UTSW	1	88,179,087 (GRCm39)	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88,165,666 (GRCm39)	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5031:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5062:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5301:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5367:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R5371:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5615:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5825:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R5891:Mroh2a	UTSW	1	88,169,337 (GRCm39)	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88,176,377 (GRCm39)	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88,158,390 (GRCm39)	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6074:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6127:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R6234:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R6244:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6575:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6809:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R8350:Mroh2a	UTSW	1	88,171,805 (GRCm39)	splice site	probably null
R9414:Mroh2a	UTSW	1	88,179,096 (GRCm39)	missense	probably benign	0.26
RF024:Mroh2a	UTSW	1	88,170,207 (GRCm39)	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88,154,813 (GRCm39)	start gained	probably benign
V8831:Mroh2a	UTSW	1	88,183,889 (GRCm39)	frame shift	probably null
X0027:Mroh2a	UTSW	1	88,176,335 (GRCm39)	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0028:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0033:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,160,014 (GRCm39)	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0039:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,183,377 (GRCm39)	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0063:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
Z1188:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
Z1190:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
Z1192:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAGCATTTAACTGACACCCCTGCC -3'
(R):5'- TGCAGAACTGGGTCGCTCATGAAC -3'

Sequencing Primer
(F):5'- GCTAAGAAGTCTGATTCAGTCCC -3'
(R):5'- TGCAGTTACCCAGGATGTCAG -3'

Posted On

2014-01-29