Incidental Mutation 'R1281:Aim2'
ID151014
Institutional Source Beutler Lab
Gene Symbol Aim2
Ensembl Gene ENSMUSG00000037860
Gene Nameabsent in melanoma 2
SynonymsLOC383619, Ifi210
MMRRC Submission 039347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1281 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173350879-173466040 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 173459811 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 126 (K126*)
Ref Sequence ENSEMBL: ENSMUSP00000132253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147604] [ENSMUST00000151176] [ENSMUST00000166137] [ENSMUST00000173023]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135370
Predicted Effect probably null
Transcript: ENSMUST00000147604
AA Change: K126*
SMART Domains Protein: ENSMUSP00000119465
Gene: ENSMUSG00000037860
AA Change: K126*

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 322 2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151176
SMART Domains Protein: ENSMUSP00000121333
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 79 9.28e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166137
AA Change: K126*
SMART Domains Protein: ENSMUSP00000132253
Gene: ENSMUSG00000037860
AA Change: K126*

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 321 9.4e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173023
SMART Domains Protein: ENSMUSP00000134329
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192575
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AIM2 is a member of the IFI20X /IFI16 family. It plays a putative role in tumorigenic reversion and may control cell proliferation. Interferon-gamma induces expression of AIM2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased susceptibility to bacterial and viral infections with altered cytokine production and inflammatory cell death (pyrotosis). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C9 A T 15: 6,489,840 N386I possibly damaging Het
Csnk1e A C 15: 79,420,641 N387K possibly damaging Het
Cul9 T C 17: 46,511,534 T1758A probably damaging Het
Dcaf17 A G 2: 71,078,156 I256V probably damaging Het
Duox1 G A 2: 122,327,088 C565Y probably damaging Het
Fchsd2 A G 7: 101,253,552 H379R possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Krt2 C A 15: 101,813,292 C438F probably damaging Het
Mast4 G A 13: 102,750,578 T1001I probably damaging Het
Mrc1 T C 2: 14,293,510 F726L probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Mttp T C 3: 138,107,219 N550S possibly damaging Het
Necap1 G T 6: 122,874,614 D16Y possibly damaging Het
Nox3 A T 17: 3,696,185 I26N probably damaging Het
Patj T C 4: 98,416,695 I262T probably damaging Het
Pcdh8 T C 14: 79,767,726 E953G probably damaging Het
Pirb A T 7: 3,717,190 C395S probably damaging Het
Sacs A G 14: 61,191,801 I433M probably benign Het
Sclt1 A G 3: 41,647,620 F552L probably benign Het
Smc5 T C 19: 23,235,883 N479S probably benign Het
Tg G A 15: 66,696,489 V1342I probably benign Het
Ube2n C A 10: 95,541,756 N132K probably benign Het
Vmn2r55 A T 7: 12,670,898 C193S probably benign Het
Zc3hav1 A G 6: 38,353,937 C96R probably damaging Het
Zfp60 T A 7: 27,738,427 V53E probably damaging Het
Other mutations in Aim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Aim2 APN 1 173455465 missense probably benign 0.23
IGL01086:Aim2 APN 1 173455433 missense probably damaging 0.99
IGL02292:Aim2 APN 1 173462274 missense probably benign 0.05
IGL02382:Aim2 APN 1 173459749 unclassified probably null
R0226:Aim2 UTSW 1 173462333 unclassified probably benign
R0609:Aim2 UTSW 1 173461964 missense probably damaging 0.98
R2054:Aim2 UTSW 1 173463982 missense probably damaging 1.00
R2110:Aim2 UTSW 1 173459713 missense probably benign 0.00
R4080:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4081:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4082:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4452:Aim2 UTSW 1 173455444 missense possibly damaging 0.63
R4647:Aim2 UTSW 1 173455524 synonymous silent
R4731:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4732:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4733:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4923:Aim2 UTSW 1 173459806 missense probably benign 0.04
R5009:Aim2 UTSW 1 173455366 missense probably damaging 0.96
R6290:Aim2 UTSW 1 173462115 missense possibly damaging 0.48
R6372:Aim2 UTSW 1 173455236 intron probably null
R6821:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R6836:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R6838:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R6994:Aim2 UTSW 1 173455586 missense possibly damaging 0.80
R7893:Aim2 UTSW 1 173463926 missense possibly damaging 0.95
R7976:Aim2 UTSW 1 173463926 missense possibly damaging 0.95
X0021:Aim2 UTSW 1 173463919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGACCACATATCAGTCACAGGAA -3'
(R):5'- GCAGACATATCTCTCCTATCGTAGCCC -3'

Sequencing Primer
(F):5'- gaggacctgaagatgggaaac -3'
(R):5'- ATCGTAGCCCGGTTTTCCTG -3'
Posted On2014-01-29