Incidental Mutation 'R1281:Mrc1'
ID 151015
Institutional Source Beutler Lab
Gene Symbol Mrc1
Ensembl Gene ENSMUSG00000026712
Gene Name mannose receptor, C type 1
Synonyms CD206, MR
MMRRC Submission 039347-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R1281 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 14234225-14336834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14298321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 726 (F726L)
Ref Sequence ENSEMBL: ENSMUSP00000028045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028045]
AlphaFold Q61830
PDB Structure CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028045
AA Change: F726L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: F726L

DomainStartEndE-ValueType
RICIN 22 142 8.09e-18 SMART
FN2 161 209 1.83e-27 SMART
CLECT 216 341 8.87e-26 SMART
CLECT 362 487 3.51e-38 SMART
CLECT 504 626 8.2e-30 SMART
CLECT 646 778 2.34e-34 SMART
CLECT 800 923 2.17e-29 SMART
low complexity region 935 941 N/A INTRINSIC
CLECT 944 1079 3.35e-35 SMART
CLECT 1094 1212 4.11e-21 SMART
CLECT 1229 1355 3.63e-31 SMART
transmembrane domain 1388 1410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 A T 1: 173,287,377 (GRCm39) K126* probably null Het
C9 A T 15: 6,519,321 (GRCm39) N386I possibly damaging Het
Csnk1e A C 15: 79,304,841 (GRCm39) N387K possibly damaging Het
Cul9 T C 17: 46,822,460 (GRCm39) T1758A probably damaging Het
Dcaf17 A G 2: 70,908,500 (GRCm39) I256V probably damaging Het
Duox1 G A 2: 122,157,569 (GRCm39) C565Y probably damaging Het
Fchsd2 A G 7: 100,902,759 (GRCm39) H379R possibly damaging Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Krt1c C A 15: 101,721,727 (GRCm39) C438F probably damaging Het
Mast4 G A 13: 102,887,086 (GRCm39) T1001I probably damaging Het
Mroh2a T TN 1: 88,183,889 (GRCm39) probably null Het
Mttp T C 3: 137,812,980 (GRCm39) N550S possibly damaging Het
Necap1 G T 6: 122,851,573 (GRCm39) D16Y possibly damaging Het
Nox3 A T 17: 3,746,460 (GRCm39) I26N probably damaging Het
Patj T C 4: 98,304,932 (GRCm39) I262T probably damaging Het
Pcdh8 T C 14: 80,005,166 (GRCm39) E953G probably damaging Het
Pirb A T 7: 3,720,189 (GRCm39) C395S probably damaging Het
Sacs A G 14: 61,429,250 (GRCm39) I433M probably benign Het
Sclt1 A G 3: 41,602,055 (GRCm39) F552L probably benign Het
Smc5 T C 19: 23,213,247 (GRCm39) N479S probably benign Het
Tg G A 15: 66,568,338 (GRCm39) V1342I probably benign Het
Ube2n C A 10: 95,377,618 (GRCm39) N132K probably benign Het
Vmn2r55 A T 7: 12,404,825 (GRCm39) C193S probably benign Het
Zc3hav1 A G 6: 38,330,872 (GRCm39) C96R probably damaging Het
Zfp60 T A 7: 27,437,852 (GRCm39) V53E probably damaging Het
Other mutations in Mrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mrc1 APN 2 14,333,236 (GRCm39) missense probably damaging 1.00
IGL01326:Mrc1 APN 2 14,271,335 (GRCm39) missense probably damaging 1.00
IGL01340:Mrc1 APN 2 14,314,895 (GRCm39) critical splice donor site probably null
IGL01758:Mrc1 APN 2 14,243,059 (GRCm39) missense probably damaging 1.00
IGL01799:Mrc1 APN 2 14,243,187 (GRCm39) missense probably damaging 1.00
IGL02280:Mrc1 APN 2 14,249,024 (GRCm39) missense probably benign 0.19
IGL02435:Mrc1 APN 2 14,253,671 (GRCm39) nonsense probably null
IGL03073:Mrc1 APN 2 14,310,153 (GRCm39) missense probably damaging 1.00
IGL03110:Mrc1 APN 2 14,298,289 (GRCm39) nonsense probably null
IGL03155:Mrc1 APN 2 14,335,912 (GRCm39) missense probably benign 0.00
IGL03289:Mrc1 APN 2 14,313,634 (GRCm39) critical splice donor site probably null
amlodipine UTSW 2 14,275,016 (GRCm39) missense probably damaging 1.00
losartan UTSW 2 14,299,597 (GRCm39) splice site probably null
Shug UTSW 2 14,275,017 (GRCm39) missense probably damaging 1.00
sussigkeit UTSW 2 14,330,192 (GRCm39) splice site probably null
R0011:Mrc1 UTSW 2 14,266,148 (GRCm39) critical splice donor site probably null
R0011:Mrc1 UTSW 2 14,266,148 (GRCm39) critical splice donor site probably null
R0066:Mrc1 UTSW 2 14,266,011 (GRCm39) missense probably benign 0.42
R0066:Mrc1 UTSW 2 14,266,011 (GRCm39) missense probably benign 0.42
R0110:Mrc1 UTSW 2 14,243,353 (GRCm39) splice site probably benign
R0234:Mrc1 UTSW 2 14,284,705 (GRCm39) missense possibly damaging 0.65
R0234:Mrc1 UTSW 2 14,284,705 (GRCm39) missense possibly damaging 0.65
R0381:Mrc1 UTSW 2 14,312,720 (GRCm39) missense probably benign 0.05
R0505:Mrc1 UTSW 2 14,314,843 (GRCm39) missense probably damaging 1.00
R0539:Mrc1 UTSW 2 14,274,937 (GRCm39) splice site probably benign
R0613:Mrc1 UTSW 2 14,299,630 (GRCm39) missense probably damaging 0.96
R0626:Mrc1 UTSW 2 14,333,382 (GRCm39) nonsense probably null
R1122:Mrc1 UTSW 2 14,266,147 (GRCm39) critical splice donor site probably null
R1399:Mrc1 UTSW 2 14,284,736 (GRCm39) missense probably damaging 1.00
R1428:Mrc1 UTSW 2 14,320,074 (GRCm39) missense probably benign 0.11
R1571:Mrc1 UTSW 2 14,313,544 (GRCm39) missense probably damaging 0.97
R1596:Mrc1 UTSW 2 14,253,701 (GRCm39) missense possibly damaging 0.91
R1730:Mrc1 UTSW 2 14,332,655 (GRCm39) missense probably benign 0.01
R1733:Mrc1 UTSW 2 14,261,910 (GRCm39) missense probably damaging 1.00
R1783:Mrc1 UTSW 2 14,332,655 (GRCm39) missense probably benign 0.01
R1860:Mrc1 UTSW 2 14,333,390 (GRCm39) missense probably benign 0.30
R1872:Mrc1 UTSW 2 14,330,192 (GRCm39) splice site probably null
R1889:Mrc1 UTSW 2 14,313,488 (GRCm39) critical splice acceptor site probably null
R1938:Mrc1 UTSW 2 14,324,052 (GRCm39) missense possibly damaging 0.89
R1971:Mrc1 UTSW 2 14,249,103 (GRCm39) critical splice donor site probably null
R2031:Mrc1 UTSW 2 14,326,584 (GRCm39) missense probably damaging 1.00
R2136:Mrc1 UTSW 2 14,275,000 (GRCm39) missense probably damaging 1.00
R2152:Mrc1 UTSW 2 14,332,675 (GRCm39) missense probably damaging 1.00
R2168:Mrc1 UTSW 2 14,249,015 (GRCm39) missense possibly damaging 0.90
R2273:Mrc1 UTSW 2 14,330,183 (GRCm39) missense probably damaging 1.00
R2901:Mrc1 UTSW 2 14,333,354 (GRCm39) missense possibly damaging 0.94
R3767:Mrc1 UTSW 2 14,323,981 (GRCm39) missense probably damaging 1.00
R3795:Mrc1 UTSW 2 14,293,793 (GRCm39) splice site probably benign
R4028:Mrc1 UTSW 2 14,243,059 (GRCm39) missense probably damaging 1.00
R4668:Mrc1 UTSW 2 14,298,297 (GRCm39) missense probably damaging 1.00
R4828:Mrc1 UTSW 2 14,275,017 (GRCm39) missense probably damaging 1.00
R4897:Mrc1 UTSW 2 14,323,952 (GRCm39) missense probably benign 0.01
R4950:Mrc1 UTSW 2 14,276,091 (GRCm39) missense probably damaging 1.00
R5000:Mrc1 UTSW 2 14,249,000 (GRCm39) missense probably damaging 1.00
R5068:Mrc1 UTSW 2 14,311,327 (GRCm39) missense probably benign 0.00
R5279:Mrc1 UTSW 2 14,314,869 (GRCm39) missense probably damaging 0.99
R5366:Mrc1 UTSW 2 14,326,725 (GRCm39) missense probably benign 0.03
R5436:Mrc1 UTSW 2 14,271,326 (GRCm39) missense probably damaging 1.00
R5552:Mrc1 UTSW 2 14,284,768 (GRCm39) missense probably benign 0.05
R5631:Mrc1 UTSW 2 14,333,383 (GRCm39) nonsense probably null
R5831:Mrc1 UTSW 2 14,313,523 (GRCm39) missense probably damaging 0.99
R5978:Mrc1 UTSW 2 14,320,204 (GRCm39) missense probably damaging 0.97
R5993:Mrc1 UTSW 2 14,310,138 (GRCm39) missense probably damaging 1.00
R6030:Mrc1 UTSW 2 14,321,712 (GRCm39) missense probably benign 0.04
R6030:Mrc1 UTSW 2 14,321,712 (GRCm39) missense probably benign 0.04
R6038:Mrc1 UTSW 2 14,261,882 (GRCm39) missense probably damaging 1.00
R6038:Mrc1 UTSW 2 14,261,882 (GRCm39) missense probably damaging 1.00
R6228:Mrc1 UTSW 2 14,276,115 (GRCm39) missense probably benign 0.08
R6344:Mrc1 UTSW 2 14,248,985 (GRCm39) missense probably damaging 1.00
R6457:Mrc1 UTSW 2 14,275,016 (GRCm39) missense probably damaging 1.00
R6520:Mrc1 UTSW 2 14,312,760 (GRCm39) missense probably damaging 1.00
R6619:Mrc1 UTSW 2 14,299,597 (GRCm39) splice site probably null
R6631:Mrc1 UTSW 2 14,243,296 (GRCm39) missense probably benign
R6737:Mrc1 UTSW 2 14,276,088 (GRCm39) missense possibly damaging 0.95
R6782:Mrc1 UTSW 2 14,266,148 (GRCm39) critical splice donor site probably null
R6887:Mrc1 UTSW 2 14,330,048 (GRCm39) missense possibly damaging 0.94
R7108:Mrc1 UTSW 2 14,308,957 (GRCm39) nonsense probably null
R7120:Mrc1 UTSW 2 14,313,508 (GRCm39) missense probably damaging 0.97
R7460:Mrc1 UTSW 2 14,253,680 (GRCm39) missense probably damaging 1.00
R7567:Mrc1 UTSW 2 14,330,104 (GRCm39) missense probably damaging 1.00
R7606:Mrc1 UTSW 2 14,242,955 (GRCm39) missense probably damaging 1.00
R7725:Mrc1 UTSW 2 14,284,788 (GRCm39) missense probably benign 0.03
R7826:Mrc1 UTSW 2 14,299,668 (GRCm39) missense probably damaging 1.00
R8082:Mrc1 UTSW 2 14,253,771 (GRCm39) missense probably benign
R8279:Mrc1 UTSW 2 14,271,168 (GRCm39) missense possibly damaging 0.89
R8888:Mrc1 UTSW 2 14,312,760 (GRCm39) missense probably damaging 1.00
R8895:Mrc1 UTSW 2 14,312,760 (GRCm39) missense probably damaging 1.00
R8952:Mrc1 UTSW 2 14,253,735 (GRCm39) missense probably damaging 0.98
R9315:Mrc1 UTSW 2 14,248,969 (GRCm39) nonsense probably null
R9366:Mrc1 UTSW 2 14,321,709 (GRCm39) missense probably damaging 0.99
R9373:Mrc1 UTSW 2 14,274,999 (GRCm39) missense probably damaging 0.99
R9418:Mrc1 UTSW 2 14,234,358 (GRCm39) missense probably benign 0.12
R9420:Mrc1 UTSW 2 14,312,790 (GRCm39) missense possibly damaging 0.53
R9489:Mrc1 UTSW 2 14,324,110 (GRCm39) missense probably benign 0.06
R9564:Mrc1 UTSW 2 14,266,117 (GRCm39) missense probably benign 0.00
R9572:Mrc1 UTSW 2 14,234,334 (GRCm39) missense probably benign
R9605:Mrc1 UTSW 2 14,324,110 (GRCm39) missense probably benign 0.06
R9606:Mrc1 UTSW 2 14,313,517 (GRCm39) missense probably benign 0.01
R9781:Mrc1 UTSW 2 14,310,175 (GRCm39) missense possibly damaging 0.90
R9781:Mrc1 UTSW 2 14,249,100 (GRCm39) missense probably benign
Z1177:Mrc1 UTSW 2 14,293,927 (GRCm39) missense probably damaging 1.00
Z1177:Mrc1 UTSW 2 14,248,949 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTAGTGCTCCAGGGTTCAGAATA -3'
(R):5'- TGGAGGCCAGGGCTGGACA -3'

Sequencing Primer
(F):5'- ggattggcattaggaaacagg -3'
(R):5'- GGGCTGGACAGTGTATACTAAACT -3'
Posted On 2014-01-29