Incidental Mutation 'R1281:Gjb3'
ID 151021
Institutional Source Beutler Lab
Gene Symbol Gjb3
Ensembl Gene ENSMUSG00000042367
Gene Name gap junction protein, beta 3
Synonyms Gjb-3, D4Wsu144e, Cx31, connexin 31, Cnx31
MMRRC Submission 039347-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1281 (G1)
Quality Score 221
Status Not validated
Chromosome 4
Chromosomal Location 127219028-127224633 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 127220224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 103 (R103W)
Ref Sequence ENSEMBL: ENSMUSP00000101697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046532] [ENSMUST00000106091]
AlphaFold P28231
Predicted Effect probably damaging
Transcript: ENSMUST00000046532
AA Change: R103W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046755
Gene: ENSMUSG00000042367
AA Change: R103W

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 3.47e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 209 3.05e-33 SMART
low complexity region 219 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106091
AA Change: R103W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101697
Gene: ENSMUSG00000042367
AA Change: R103W

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 3.47e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 209 3.05e-33 SMART
low complexity region 219 237 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene can cause non-syndromic deafness or erythrokeratodermia variabilis, a skin disorder. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit partial lethality and transient placental dysmorphogenesis but no impairment in hearing or skin differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 A T 1: 173,287,377 (GRCm39) K126* probably null Het
C9 A T 15: 6,519,321 (GRCm39) N386I possibly damaging Het
Csnk1e A C 15: 79,304,841 (GRCm39) N387K possibly damaging Het
Cul9 T C 17: 46,822,460 (GRCm39) T1758A probably damaging Het
Dcaf17 A G 2: 70,908,500 (GRCm39) I256V probably damaging Het
Duox1 G A 2: 122,157,569 (GRCm39) C565Y probably damaging Het
Fchsd2 A G 7: 100,902,759 (GRCm39) H379R possibly damaging Het
Krt1c C A 15: 101,721,727 (GRCm39) C438F probably damaging Het
Mast4 G A 13: 102,887,086 (GRCm39) T1001I probably damaging Het
Mrc1 T C 2: 14,298,321 (GRCm39) F726L probably damaging Het
Mroh2a T TN 1: 88,183,889 (GRCm39) probably null Het
Mttp T C 3: 137,812,980 (GRCm39) N550S possibly damaging Het
Necap1 G T 6: 122,851,573 (GRCm39) D16Y possibly damaging Het
Nox3 A T 17: 3,746,460 (GRCm39) I26N probably damaging Het
Patj T C 4: 98,304,932 (GRCm39) I262T probably damaging Het
Pcdh8 T C 14: 80,005,166 (GRCm39) E953G probably damaging Het
Pirb A T 7: 3,720,189 (GRCm39) C395S probably damaging Het
Sacs A G 14: 61,429,250 (GRCm39) I433M probably benign Het
Sclt1 A G 3: 41,602,055 (GRCm39) F552L probably benign Het
Smc5 T C 19: 23,213,247 (GRCm39) N479S probably benign Het
Tg G A 15: 66,568,338 (GRCm39) V1342I probably benign Het
Ube2n C A 10: 95,377,618 (GRCm39) N132K probably benign Het
Vmn2r55 A T 7: 12,404,825 (GRCm39) C193S probably benign Het
Zc3hav1 A G 6: 38,330,872 (GRCm39) C96R probably damaging Het
Zfp60 T A 7: 27,437,852 (GRCm39) V53E probably damaging Het
Other mutations in Gjb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Gjb3 APN 4 127,219,914 (GRCm39) missense probably damaging 0.99
IGL02398:Gjb3 APN 4 127,219,855 (GRCm39) missense probably benign 0.00
IGL02501:Gjb3 APN 4 127,220,157 (GRCm39) missense probably damaging 1.00
IGL02680:Gjb3 APN 4 127,219,815 (GRCm39) missense probably damaging 0.98
R0118:Gjb3 UTSW 4 127,220,451 (GRCm39) missense probably damaging 1.00
R0481:Gjb3 UTSW 4 127,220,125 (GRCm39) missense probably benign 0.00
R1142:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1250:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1279:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1280:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1282:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1322:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1324:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1325:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1341:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1382:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1799:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1834:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1836:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R4650:Gjb3 UTSW 4 127,220,484 (GRCm39) missense probably damaging 1.00
R5026:Gjb3 UTSW 4 127,220,280 (GRCm39) missense probably damaging 1.00
R6310:Gjb3 UTSW 4 127,220,433 (GRCm39) missense probably damaging 0.99
R6357:Gjb3 UTSW 4 127,220,423 (GRCm39) nonsense probably null
R9092:Gjb3 UTSW 4 127,220,471 (GRCm39) frame shift probably null
R9092:Gjb3 UTSW 4 127,220,458 (GRCm39) frame shift probably null
R9093:Gjb3 UTSW 4 127,220,458 (GRCm39) frame shift probably null
R9094:Gjb3 UTSW 4 127,220,458 (GRCm39) frame shift probably null
R9145:Gjb3 UTSW 4 127,220,140 (GRCm39) missense probably damaging 1.00
R9511:Gjb3 UTSW 4 127,220,131 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTAGCAATCCACGGTGTTGGGG -3'
(R):5'- CGCATCTGGCTGTCAGTAGTGTTC -3'

Sequencing Primer
(F):5'- TGGCGCACTGTACCAGAC -3'
(R):5'- TCAGTAGTGTTCGTCTTCCG -3'
Posted On 2014-01-29