Incidental Mutation 'R1281:Vmn2r55'
ID151025
Institutional Source Beutler Lab
Gene Symbol Vmn2r55
Ensembl Gene ENSMUSG00000091045
Gene Namevomeronasal 2, receptor 55
Synonyms
MMRRC Submission 039347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1281 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12651706-12684991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12670898 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 193 (C193S)
Ref Sequence ENSEMBL: ENSMUSP00000132834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167771] [ENSMUST00000172743]
Predicted Effect probably benign
Transcript: ENSMUST00000167771
AA Change: C193S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132834
Gene: ENSMUSG00000091045
AA Change: C193S

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 398 6.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172743
AA Change: C193S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133483
Gene: ENSMUSG00000091045
AA Change: C193S

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.4e-57 PFAM
Pfam:7tm_3 525 762 3.7e-54 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 A T 1: 173,459,811 K126* probably null Het
C9 A T 15: 6,489,840 N386I possibly damaging Het
Csnk1e A C 15: 79,420,641 N387K possibly damaging Het
Cul9 T C 17: 46,511,534 T1758A probably damaging Het
Dcaf17 A G 2: 71,078,156 I256V probably damaging Het
Duox1 G A 2: 122,327,088 C565Y probably damaging Het
Fchsd2 A G 7: 101,253,552 H379R possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Krt2 C A 15: 101,813,292 C438F probably damaging Het
Mast4 G A 13: 102,750,578 T1001I probably damaging Het
Mrc1 T C 2: 14,293,510 F726L probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Mttp T C 3: 138,107,219 N550S possibly damaging Het
Necap1 G T 6: 122,874,614 D16Y possibly damaging Het
Nox3 A T 17: 3,696,185 I26N probably damaging Het
Patj T C 4: 98,416,695 I262T probably damaging Het
Pcdh8 T C 14: 79,767,726 E953G probably damaging Het
Pirb A T 7: 3,717,190 C395S probably damaging Het
Sacs A G 14: 61,191,801 I433M probably benign Het
Sclt1 A G 3: 41,647,620 F552L probably benign Het
Smc5 T C 19: 23,235,883 N479S probably benign Het
Tg G A 15: 66,696,489 V1342I probably benign Het
Ube2n C A 10: 95,541,756 N132K probably benign Het
Zc3hav1 A G 6: 38,353,937 C96R probably damaging Het
Zfp60 T A 7: 27,738,427 V53E probably damaging Het
Other mutations in Vmn2r55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Vmn2r55 APN 7 12670960 missense probably damaging 1.00
IGL03035:Vmn2r55 APN 7 12670816 missense probably benign 0.01
IGL03115:Vmn2r55 APN 7 12670631 missense probably damaging 1.00
IGL03251:Vmn2r55 APN 7 12671193 splice site probably benign
R0140:Vmn2r55 UTSW 7 12668177 missense possibly damaging 0.58
R0511:Vmn2r55 UTSW 7 12671018 missense possibly damaging 0.88
R1564:Vmn2r55 UTSW 7 12684751 missense probably damaging 1.00
R1602:Vmn2r55 UTSW 7 12652644 missense probably damaging 1.00
R1785:Vmn2r55 UTSW 7 12668184 missense probably damaging 0.98
R2939:Vmn2r55 UTSW 7 12651905 missense probably damaging 1.00
R2993:Vmn2r55 UTSW 7 12684955 missense probably damaging 1.00
R3151:Vmn2r55 UTSW 7 12670707 missense probably benign 0.06
R4272:Vmn2r55 UTSW 7 12668179 missense probably benign 0.38
R4589:Vmn2r55 UTSW 7 12670895 missense probably damaging 0.99
R4624:Vmn2r55 UTSW 7 12670700 missense possibly damaging 0.83
R4965:Vmn2r55 UTSW 7 12670551 missense possibly damaging 0.91
R5294:Vmn2r55 UTSW 7 12651864 missense probably damaging 1.00
R5364:Vmn2r55 UTSW 7 12670903 missense possibly damaging 0.51
R5395:Vmn2r55 UTSW 7 12651947 missense probably damaging 1.00
R5401:Vmn2r55 UTSW 7 12651944 missense probably benign
R5701:Vmn2r55 UTSW 7 12670565 missense probably benign 0.00
R5771:Vmn2r55 UTSW 7 12671032 missense probably damaging 1.00
R5846:Vmn2r55 UTSW 7 12670565 missense probably benign 0.05
R6148:Vmn2r55 UTSW 7 12668142 missense probably benign 0.01
R6159:Vmn2r55 UTSW 7 12651771 missense probably damaging 1.00
R6541:Vmn2r55 UTSW 7 12671012 missense probably damaging 1.00
R7286:Vmn2r55 UTSW 7 12652073 missense probably damaging 0.99
R7483:Vmn2r55 UTSW 7 12670828 missense probably benign 0.00
R8269:Vmn2r55 UTSW 7 12670658 missense possibly damaging 0.86
Z1177:Vmn2r55 UTSW 7 12651837 missense possibly damaging 0.83
Z1177:Vmn2r55 UTSW 7 12671179 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCCAAATGTGCCTTGCAACACC -3'
(R):5'- ACCCAGTCTGAGTGACAAGATCCAG -3'

Sequencing Primer
(F):5'- CTTGCAACACCTGGGAAATG -3'
(R):5'- CTGAGTGACAAGATCCAGTTTCC -3'
Posted On2014-01-29