Incidental Mutation 'R1281:Nox3'
ID151038
Institutional Source Beutler Lab
Gene Symbol Nox3
Ensembl Gene ENSMUSG00000023802
Gene NameNADPH oxidase 3
Synonymsnmf250, het
MMRRC Submission 039347-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R1281 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location3635240-3696261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3696185 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 26 (I26N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115800]
Predicted Effect probably damaging
Transcript: ENSMUST00000024565
AA Change: I26N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024565
Gene: ENSMUSG00000023802
AA Change: I26N

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Ferric_reduct 75 238 8.6e-28 PFAM
Pfam:FAD_binding_8 311 413 4.1e-26 PFAM
Pfam:NAD_binding_6 419 569 1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115800
AA Change: I6N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111466
Gene: ENSMUSG00000023802
AA Change: I6N

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 55 218 5.4e-23 PFAM
Pfam:FAD_binding_6 290 379 1.8e-8 PFAM
Pfam:FAD_binding_8 291 393 1.5e-27 PFAM
Pfam:NAD_binding_6 399 549 1e-34 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NOX family of NADPH oxidases. These enzymes catalyze the transfer of electrons from NADPH to molecular oxygen to produce superoxide and other reactive oxygen species (ROS). The ROS generated by family members have been implicated in numerous biological functions including host defense, posttranlational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation. The protein encoded by this gene is expressed predominantly in the inner ear and is involved in the biogenesis of otoconia, which are crystalline structures of the inner ear involved in the perception of gravity and linear acceleration. In mouse mutations of this gene lead to the absence of otoconia and vestibular dysfunction. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous mutants bilaterally lack otoliths in otherwise normal ears and display impaired swimming ability, motor capabilities, and vestibular responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 A T 1: 173,459,811 K126* probably null Het
C9 A T 15: 6,489,840 N386I possibly damaging Het
Csnk1e A C 15: 79,420,641 N387K possibly damaging Het
Cul9 T C 17: 46,511,534 T1758A probably damaging Het
Dcaf17 A G 2: 71,078,156 I256V probably damaging Het
Duox1 G A 2: 122,327,088 C565Y probably damaging Het
Fchsd2 A G 7: 101,253,552 H379R possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Krt2 C A 15: 101,813,292 C438F probably damaging Het
Mast4 G A 13: 102,750,578 T1001I probably damaging Het
Mrc1 T C 2: 14,293,510 F726L probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Mttp T C 3: 138,107,219 N550S possibly damaging Het
Necap1 G T 6: 122,874,614 D16Y possibly damaging Het
Patj T C 4: 98,416,695 I262T probably damaging Het
Pcdh8 T C 14: 79,767,726 E953G probably damaging Het
Pirb A T 7: 3,717,190 C395S probably damaging Het
Sacs A G 14: 61,191,801 I433M probably benign Het
Sclt1 A G 3: 41,647,620 F552L probably benign Het
Smc5 T C 19: 23,235,883 N479S probably benign Het
Tg G A 15: 66,696,489 V1342I probably benign Het
Ube2n C A 10: 95,541,756 N132K probably benign Het
Vmn2r55 A T 7: 12,670,898 C193S probably benign Het
Zc3hav1 A G 6: 38,353,937 C96R probably damaging Het
Zfp60 T A 7: 27,738,427 V53E probably damaging Het
Other mutations in Nox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Nox3 APN 17 3683015 missense probably damaging 0.99
IGL01135:Nox3 APN 17 3696252 utr 5 prime probably benign
IGL01791:Nox3 APN 17 3682943 missense possibly damaging 0.68
IGL02423:Nox3 APN 17 3682916 missense probably damaging 1.00
IGL03091:Nox3 APN 17 3665844 missense probably benign 0.42
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0085:Nox3 UTSW 17 3635281 missense probably benign 0.14
R0426:Nox3 UTSW 17 3695563 missense probably damaging 1.00
R0690:Nox3 UTSW 17 3695564 missense probably damaging 1.00
R1350:Nox3 UTSW 17 3650121 missense probably damaging 1.00
R1843:Nox3 UTSW 17 3669878 missense probably damaging 1.00
R1902:Nox3 UTSW 17 3670017 missense probably damaging 1.00
R2023:Nox3 UTSW 17 3694021 splice site probably benign
R2762:Nox3 UTSW 17 3696158 missense probably benign 0.35
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R4429:Nox3 UTSW 17 3682958 missense probably benign 0.05
R4630:Nox3 UTSW 17 3693982 missense possibly damaging 0.53
R4926:Nox3 UTSW 17 3669894 missense probably damaging 1.00
R4928:Nox3 UTSW 17 3635275 missense probably null 1.00
R5181:Nox3 UTSW 17 3635286 nonsense probably null
R6911:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R6912:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R7486:Nox3 UTSW 17 3669944 missense probably damaging 1.00
R7529:Nox3 UTSW 17 3671775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGAGATCACTGCTATGGGCCAC -3'
(R):5'- AATTCCTTGAGAGCTGCTCCCAAC -3'

Sequencing Primer
(F):5'- GTTTCACAGGCTGATTCACAGAC -3'
(R):5'- TGCTCCCAACAGGTGCTC -3'
Posted On2014-01-29