Mutagenetix > Incidental Mutation

Incidental Mutation 'R1282:Cfap65'

151043

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

039348-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.677) question?

Stock #

R1282 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74941230-74974758 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74964263 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 562 (T562S)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably benign
Transcript: ENSMUST00000094844
AA Change: T562S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: T562S

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139950

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acmsd	T	C	1: 127,666,297 (GRCm39)	Y23H	probably damaging	Het
Alkbh2	C	T	5: 114,262,287 (GRCm39)	E148K	probably damaging	Het
Atp2a2	G	T	5: 122,629,817 (GRCm39)	T84K	probably benign	Het
Cyp2b10	G	A	7: 25,625,505 (GRCm39)	C436Y	probably damaging	Het
Dnajc7	T	C	11: 100,475,467 (GRCm39)	D381G	probably damaging	Het
Dnase1l3	T	C	14: 7,983,117 (GRCm38)	D129G	probably benign	Het
Espl1	A	G	15: 102,223,826 (GRCm39)	T1126A	probably benign	Het
Exoc3	T	C	13: 74,330,411 (GRCm39)	N506S	probably benign	Het
Fastkd3	C	A	13: 68,732,676 (GRCm39)	N332K	possibly damaging	Het
Fbxw15	G	A	9: 109,387,314 (GRCm39)	S227F	probably damaging	Het
Foxp4	G	A	17: 48,186,568 (GRCm39)	P404S	unknown	Het
Gjb3	G	A	4: 127,220,224 (GRCm39)	R103W	probably damaging	Het
Gm12789	T	A	4: 101,845,487 (GRCm39)	W59R	probably damaging	Het
Greb1l	T	A	18: 10,547,289 (GRCm39)	N1502K	probably benign	Het
H2-K2	A	C	17: 34,218,421 (GRCm39)	I165S	probably damaging	Het
Ipo9	A	G	1: 135,330,030 (GRCm39)	I470T	possibly damaging	Het
Kcnu1	A	T	8: 26,395,985 (GRCm39)	I657F	probably benign	Het
Lrp1b	A	T	2: 40,750,773 (GRCm39)	N2930K	probably damaging	Het
Or56a5	T	A	7: 104,792,859 (GRCm39)	I220F	probably benign	Het
Prag1	T	C	8: 36,567,068 (GRCm39)	V73A	probably damaging	Het
Prrc2b	T	C	2: 32,113,456 (GRCm39)	I1963T	probably damaging	Het
Rep15	C	T	6: 146,934,727 (GRCm39)	R189*	probably null	Het
Resf1	C	T	6: 149,230,670 (GRCm39)	Q1239*	probably null	Het
Rtp3	T	C	9: 110,815,988 (GRCm39)	K188E	probably benign	Het
Scd2	T	C	19: 44,283,620 (GRCm39)	L101P	probably damaging	Het
Scn7a	A	T	2: 66,531,193 (GRCm39)	H561Q	probably damaging	Het
Sfr1	T	C	19: 47,721,407 (GRCm39)	S118P	probably damaging	Het
Slf1	C	T	13: 77,191,959 (GRCm39)	M958I	probably damaging	Het
Snrk	G	T	9: 121,989,586 (GRCm39)	R310L	possibly damaging	Het
Snx11	T	C	11: 96,663,987 (GRCm39)	Y35C	probably damaging	Het
Supt6	T	C	11: 78,119,594 (GRCm39)	T404A	possibly damaging	Het
Svep1	C	A	4: 58,100,032 (GRCm39)	L1337F	possibly damaging	Het
Traf3ip2	C	T	10: 39,502,401 (GRCm39)	T183M	probably damaging	Het
Vmn2r28	A	T	7: 5,484,301 (GRCm39)	M633K	probably damaging	Het
Vmn2r67	A	G	7: 84,785,932 (GRCm39)	V691A	probably benign	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74,958,342 (GRCm39)	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74,950,237 (GRCm39)	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74,966,353 (GRCm39)	missense	probably benign
IGL01780:Cfap65	APN	1	74,967,507 (GRCm39)	nonsense	probably null
IGL01993:Cfap65	APN	1	74,959,702 (GRCm39)	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74,967,304 (GRCm39)	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74,967,507 (GRCm39)	nonsense	probably null
IGL02357:Cfap65	APN	1	74,967,507 (GRCm39)	nonsense	probably null
IGL02576:Cfap65	APN	1	74,942,617 (GRCm39)	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74,944,239 (GRCm39)	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74,966,337 (GRCm39)	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74,950,267 (GRCm39)	nonsense	probably null
IGL03101:Cfap65	APN	1	74,967,592 (GRCm39)	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74,966,778 (GRCm39)	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74,943,801 (GRCm39)	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74,967,501 (GRCm39)	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74,971,077 (GRCm39)	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74,971,117 (GRCm39)	nonsense	probably null
R0281:Cfap65	UTSW	1	74,966,230 (GRCm39)	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74,943,226 (GRCm39)	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74,968,461 (GRCm39)	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74,968,460 (GRCm39)	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74,965,603 (GRCm39)	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74,959,760 (GRCm39)	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74,964,599 (GRCm39)	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74,956,043 (GRCm39)	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74,957,603 (GRCm39)	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74,941,328 (GRCm39)	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74,958,046 (GRCm39)	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74,943,841 (GRCm39)	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74,960,678 (GRCm39)	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74,944,872 (GRCm39)	missense	probably damaging	0.99
R1079:Cfap65	UTSW	1	74,941,606 (GRCm39)	missense	probably damaging	0.98
R1083:Cfap65	UTSW	1	74,957,663 (GRCm39)	splice site	probably benign
R1159:Cfap65	UTSW	1	74,968,499 (GRCm39)	missense	probably damaging	1.00
R1644:Cfap65	UTSW	1	74,956,334 (GRCm39)	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74,958,107 (GRCm39)	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74,946,819 (GRCm39)	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74,956,358 (GRCm39)	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74,946,850 (GRCm39)	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74,956,432 (GRCm39)	frame shift	probably null
R2219:Cfap65	UTSW	1	74,943,184 (GRCm39)	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74,943,184 (GRCm39)	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74,965,634 (GRCm39)	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74,966,345 (GRCm39)	small insertion	probably benign
R3114:Cfap65	UTSW	1	74,966,291 (GRCm39)	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74,959,701 (GRCm39)	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74,966,840 (GRCm39)	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74,942,517 (GRCm39)	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74,946,771 (GRCm39)	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74,946,771 (GRCm39)	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74,943,215 (GRCm39)	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74,964,513 (GRCm39)	intron	probably benign
R4701:Cfap65	UTSW	1	74,958,067 (GRCm39)	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74,967,520 (GRCm39)	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74,966,791 (GRCm39)	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74,956,454 (GRCm39)	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74,964,716 (GRCm39)	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74,958,420 (GRCm39)	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74,946,772 (GRCm39)	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74,942,283 (GRCm39)	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74,945,495 (GRCm39)	nonsense	probably null
R5074:Cfap65	UTSW	1	74,962,137 (GRCm39)	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74,945,600 (GRCm39)	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74,965,675 (GRCm39)	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74,964,061 (GRCm39)	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74,942,334 (GRCm39)	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74,964,259 (GRCm39)	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74,946,677 (GRCm39)	intron	probably benign
R5669:Cfap65	UTSW	1	74,964,127 (GRCm39)	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74,962,190 (GRCm39)	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74,959,564 (GRCm39)	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74,942,298 (GRCm39)	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74,966,868 (GRCm39)	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74,943,844 (GRCm39)	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74,956,445 (GRCm39)	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74,971,180 (GRCm39)	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74,964,274 (GRCm39)	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74,971,058 (GRCm39)	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74,965,792 (GRCm39)	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74,965,763 (GRCm39)	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74,960,742 (GRCm39)	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74,959,585 (GRCm39)	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74,965,769 (GRCm39)	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74,941,593 (GRCm39)	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74,972,303 (GRCm39)	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74,967,527 (GRCm39)	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74,965,784 (GRCm39)	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74,972,321 (GRCm39)	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74,949,902 (GRCm39)	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74,956,328 (GRCm39)	nonsense	probably null
R8431:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74,945,096 (GRCm39)	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74,942,382 (GRCm39)	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74,941,347 (GRCm39)	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74,959,552 (GRCm39)	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74,943,847 (GRCm39)	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74,958,510 (GRCm39)	splice site	probably benign
R9187:Cfap65	UTSW	1	74,956,517 (GRCm39)	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74,959,567 (GRCm39)	missense	probably benign
R9212:Cfap65	UTSW	1	74,959,567 (GRCm39)	missense	probably benign
R9273:Cfap65	UTSW	1	74,960,769 (GRCm39)	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74,944,210 (GRCm39)	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74,945,468 (GRCm39)	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74,946,537 (GRCm39)	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74,958,501 (GRCm39)	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74,943,840 (GRCm39)	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74,944,806 (GRCm39)	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74,949,906 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAGCTCCACAGCATAGAGGCAG -3'
(R):5'- CCGCATGGAACACTTGAAGCAC -3'

Sequencing Primer
(F):5'- ACTAGTGACTGGGGTCACC -3'
(R):5'- ACACTTGAAGCACTTGAGAGG -3'

Posted On

2014-01-29