Incidental Mutation 'R1282:Acmsd'
ID151044
Institutional Source Beutler Lab
Gene Symbol Acmsd
Ensembl Gene ENSMUSG00000026348
Gene Nameamino carboxymuconate semialdehyde decarboxylase
Synonyms
MMRRC Submission 039348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1282 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location127729413-127767978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127738560 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 23 (Y23H)
Ref Sequence ENSEMBL: ENSMUSP00000048482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038006]
Predicted Effect probably damaging
Transcript: ENSMUST00000038006
AA Change: Y23H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048482
Gene: ENSMUSG00000026348
AA Change: Y23H

DomainStartEndE-ValueType
Pfam:Amidohydro_2 3 330 7.8e-78 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neuronal excitotoxin quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan, and has been implicated in the pathogenesis of several neurodegenerative disorders. Quinolinate is derived from alpha-amino-beta-carboxy-muconate-epsilon-semialdehyde (ACMS). ACMSD (ACMS decarboxylase; EC 4.1.1.45) can divert ACMS to a benign catabolite and thus prevent the accumulation of quinolinate from ACMS.[supplied by OMIM, Oct 2004]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,172 Q1239* probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp2a2 G T 5: 122,491,754 T84K probably benign Het
Cfap65 T A 1: 74,925,104 T562S probably benign Het
Cyp2b10 G A 7: 25,926,080 C436Y probably damaging Het
Dnajc7 T C 11: 100,584,641 D381G probably damaging Het
Dnase1l3 T C 14: 7,983,117 D129G probably benign Het
Espl1 A G 15: 102,315,391 T1126A probably benign Het
Exoc3 T C 13: 74,182,292 N506S probably benign Het
Fastkd3 C A 13: 68,584,557 N332K possibly damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxp4 G A 17: 47,875,643 P404S unknown Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm12789 T A 4: 101,988,290 W59R probably damaging Het
Greb1l T A 18: 10,547,289 N1502K probably benign Het
H2-K1 A C 17: 33,999,447 I165S probably damaging Het
Ipo9 A G 1: 135,402,292 I470T possibly damaging Het
Kcnu1 A T 8: 25,905,957 I657F probably benign Het
Lrp1b A T 2: 40,860,761 N2930K probably damaging Het
Olfr683 T A 7: 105,143,652 I220F probably benign Het
Prag1 T C 8: 36,099,914 V73A probably damaging Het
Prrc2b T C 2: 32,223,444 I1963T probably damaging Het
Rep15 C T 6: 147,033,229 R189* probably null Het
Rtp3 T C 9: 110,986,920 K188E probably benign Het
Scd2 T C 19: 44,295,181 L101P probably damaging Het
Scn7a A T 2: 66,700,849 H561Q probably damaging Het
Sfr1 T C 19: 47,732,968 S118P probably damaging Het
Slf1 C T 13: 77,043,840 M958I probably damaging Het
Snrk G T 9: 122,160,520 R310L possibly damaging Het
Snx11 T C 11: 96,773,161 Y35C probably damaging Het
Supt6 T C 11: 78,228,768 T404A possibly damaging Het
Svep1 C A 4: 58,100,032 L1337F possibly damaging Het
Traf3ip2 C T 10: 39,626,405 T183M probably damaging Het
Vmn2r28 A T 7: 5,481,302 M633K probably damaging Het
Vmn2r67 A G 7: 85,136,724 V691A probably benign Het
Other mutations in Acmsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Acmsd APN 1 127759710 missense probably damaging 1.00
IGL02203:Acmsd APN 1 127738605 splice site probably benign
IGL02209:Acmsd APN 1 127759755 missense probably damaging 1.00
IGL02429:Acmsd APN 1 127759716 missense probably damaging 1.00
IGL02577:Acmsd APN 1 127739959 missense probably benign 0.05
IGL02724:Acmsd APN 1 127749085 missense possibly damaging 0.84
IGL03215:Acmsd APN 1 127758013 nonsense probably null
H8562:Acmsd UTSW 1 127749058 missense probably benign
R0535:Acmsd UTSW 1 127765943 missense probably benign 0.10
R0551:Acmsd UTSW 1 127766333 missense probably benign 0.05
R0593:Acmsd UTSW 1 127738603 splice site probably benign
R1633:Acmsd UTSW 1 127753855 missense probably benign 0.33
R1800:Acmsd UTSW 1 127759756 nonsense probably null
R3018:Acmsd UTSW 1 127749116 missense probably benign 0.11
R4195:Acmsd UTSW 1 127749194 missense probably damaging 1.00
R4196:Acmsd UTSW 1 127749194 missense probably damaging 1.00
R4288:Acmsd UTSW 1 127738572 missense probably damaging 1.00
R4591:Acmsd UTSW 1 127749197 missense probably damaging 0.99
R5172:Acmsd UTSW 1 127753848 nonsense probably null
R5637:Acmsd UTSW 1 127766313 missense probably damaging 0.99
R6147:Acmsd UTSW 1 127729420 start gained probably benign
R7055:Acmsd UTSW 1 127753833 missense probably benign 0.10
R7261:Acmsd UTSW 1 127759824 missense probably damaging 1.00
R7398:Acmsd UTSW 1 127729435 start gained probably benign
X0067:Acmsd UTSW 1 127759731 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GACACATGATGAAGGTATGAAGTCCCC -3'
(R):5'- ATTTGCCCTACTGCATGGCTGC -3'

Sequencing Primer
(F):5'- tcctcctcctcctcctcc -3'
(R):5'- GCATGGCTGCTTCCTTGC -3'
Posted On2014-01-29