Incidental Mutation 'R1282:Rep15'
ID151055
Institutional Source Beutler Lab
Gene Symbol Rep15
Ensembl Gene ENSMUSG00000040121
Gene NameRAB15 effector protein
Synonyms
MMRRC Submission 039348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1282 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location147032584-147034245 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 147033229 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 189 (R189*)
Ref Sequence ENSEMBL: ENSMUSP00000037503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000036194] [ENSMUST00000111623]
Predicted Effect probably benign
Transcript: ENSMUST00000016631
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000036194
AA Change: R189*
SMART Domains Protein: ENSMUSP00000037503
Gene: ENSMUSG00000040121
AA Change: R189*

DomainStartEndE-ValueType
Pfam:Rab15_effector 1 230 3.2e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111623
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205044
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene interacts with GTP-bound Rab15 and is involved in recycling of transferrin receptor from the endocytic recycling compartment to the cell surface. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,172 Q1239* probably null Het
Acmsd T C 1: 127,738,560 Y23H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp2a2 G T 5: 122,491,754 T84K probably benign Het
Cfap65 T A 1: 74,925,104 T562S probably benign Het
Cyp2b10 G A 7: 25,926,080 C436Y probably damaging Het
Dnajc7 T C 11: 100,584,641 D381G probably damaging Het
Dnase1l3 T C 14: 7,983,117 D129G probably benign Het
Espl1 A G 15: 102,315,391 T1126A probably benign Het
Exoc3 T C 13: 74,182,292 N506S probably benign Het
Fastkd3 C A 13: 68,584,557 N332K possibly damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxp4 G A 17: 47,875,643 P404S unknown Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm12789 T A 4: 101,988,290 W59R probably damaging Het
Greb1l T A 18: 10,547,289 N1502K probably benign Het
H2-K1 A C 17: 33,999,447 I165S probably damaging Het
Ipo9 A G 1: 135,402,292 I470T possibly damaging Het
Kcnu1 A T 8: 25,905,957 I657F probably benign Het
Lrp1b A T 2: 40,860,761 N2930K probably damaging Het
Olfr683 T A 7: 105,143,652 I220F probably benign Het
Prag1 T C 8: 36,099,914 V73A probably damaging Het
Prrc2b T C 2: 32,223,444 I1963T probably damaging Het
Rtp3 T C 9: 110,986,920 K188E probably benign Het
Scd2 T C 19: 44,295,181 L101P probably damaging Het
Scn7a A T 2: 66,700,849 H561Q probably damaging Het
Sfr1 T C 19: 47,732,968 S118P probably damaging Het
Slf1 C T 13: 77,043,840 M958I probably damaging Het
Snrk G T 9: 122,160,520 R310L possibly damaging Het
Snx11 T C 11: 96,773,161 Y35C probably damaging Het
Supt6 T C 11: 78,228,768 T404A possibly damaging Het
Svep1 C A 4: 58,100,032 L1337F possibly damaging Het
Traf3ip2 C T 10: 39,626,405 T183M probably damaging Het
Vmn2r28 A T 7: 5,481,302 M633K probably damaging Het
Vmn2r67 A G 7: 85,136,724 V691A probably benign Het
Other mutations in Rep15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Rep15 APN 6 147033347 missense probably benign 0.00
IGL03324:Rep15 APN 6 147032665 start codon destroyed possibly damaging 0.87
R1486:Rep15 UTSW 6 147033079 missense probably damaging 1.00
R2102:Rep15 UTSW 6 147032905 unclassified probably null
R5613:Rep15 UTSW 6 147032854 missense possibly damaging 0.65
R7794:Rep15 UTSW 6 147033140 missense probably damaging 0.97
X0028:Rep15 UTSW 6 147032732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATACGGCTTCAGGTGGCAGTG -3'
(R):5'- TCACAGCAACATGCCCAGTTTAGAG -3'

Sequencing Primer
(F):5'- TGACGGACCCAAAATCCTGTG -3'
(R):5'- CATGCCCAGTTTAGAGGATGC -3'
Posted On2014-01-29