Incidental Mutation 'R1282:Vmn2r28'
ID 151057
Institutional Source Beutler Lab
Gene Symbol Vmn2r28
Ensembl Gene ENSMUSG00000066820
Gene Name vomeronasal 2, receptor 28
Synonyms EG665255
MMRRC Submission 039348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R1282 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 5479531-5493967 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5481302 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 633 (M633K)
Ref Sequence ENSEMBL: ENSMUSP00000083477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086297]
AlphaFold L7N203
Predicted Effect probably damaging
Transcript: ENSMUST00000086297
AA Change: M633K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083477
Gene: ENSMUSG00000066820
AA Change: M633K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 1.7e-26 PFAM
Pfam:NCD3G 512 565 9.8e-21 PFAM
Pfam:7tm_3 598 833 2.8e-56 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,172 Q1239* probably null Het
Acmsd T C 1: 127,738,560 Y23H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp2a2 G T 5: 122,491,754 T84K probably benign Het
Cfap65 T A 1: 74,925,104 T562S probably benign Het
Cyp2b10 G A 7: 25,926,080 C436Y probably damaging Het
Dnajc7 T C 11: 100,584,641 D381G probably damaging Het
Dnase1l3 T C 14: 7,983,117 D129G probably benign Het
Espl1 A G 15: 102,315,391 T1126A probably benign Het
Exoc3 T C 13: 74,182,292 N506S probably benign Het
Fastkd3 C A 13: 68,584,557 N332K possibly damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxp4 G A 17: 47,875,643 P404S unknown Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm12789 T A 4: 101,988,290 W59R probably damaging Het
Greb1l T A 18: 10,547,289 N1502K probably benign Het
H2-K1 A C 17: 33,999,447 I165S probably damaging Het
Ipo9 A G 1: 135,402,292 I470T possibly damaging Het
Kcnu1 A T 8: 25,905,957 I657F probably benign Het
Lrp1b A T 2: 40,860,761 N2930K probably damaging Het
Olfr683 T A 7: 105,143,652 I220F probably benign Het
Prag1 T C 8: 36,099,914 V73A probably damaging Het
Prrc2b T C 2: 32,223,444 I1963T probably damaging Het
Rep15 C T 6: 147,033,229 R189* probably null Het
Rtp3 T C 9: 110,986,920 K188E probably benign Het
Scd2 T C 19: 44,295,181 L101P probably damaging Het
Scn7a A T 2: 66,700,849 H561Q probably damaging Het
Sfr1 T C 19: 47,732,968 S118P probably damaging Het
Slf1 C T 13: 77,043,840 M958I probably damaging Het
Snrk G T 9: 122,160,520 R310L possibly damaging Het
Snx11 T C 11: 96,773,161 Y35C probably damaging Het
Supt6 T C 11: 78,228,768 T404A possibly damaging Het
Svep1 C A 4: 58,100,032 L1337F possibly damaging Het
Traf3ip2 C T 10: 39,626,405 T183M probably damaging Het
Vmn2r67 A G 7: 85,136,724 V691A probably benign Het
Other mutations in Vmn2r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Vmn2r28 APN 7 5488069 missense probably benign 0.12
IGL01061:Vmn2r28 APN 7 5488184 missense probably damaging 1.00
IGL01160:Vmn2r28 APN 7 5486478 missense probably damaging 0.99
IGL01335:Vmn2r28 APN 7 5481088 missense possibly damaging 0.67
IGL01532:Vmn2r28 APN 7 5486464 missense probably benign 0.16
IGL01791:Vmn2r28 APN 7 5488162 missense probably benign 0.00
IGL01875:Vmn2r28 APN 7 5481303 missense probably benign 0.30
IGL02161:Vmn2r28 APN 7 5488124 missense possibly damaging 0.88
IGL02499:Vmn2r28 APN 7 5490569 missense probably damaging 0.98
IGL02858:Vmn2r28 APN 7 5481004 missense probably damaging 0.99
IGL03061:Vmn2r28 APN 7 5484016 missense probably damaging 0.98
G1patch:Vmn2r28 UTSW 7 5488409 missense probably benign 0.13
R0288:Vmn2r28 UTSW 7 5488021 missense probably damaging 1.00
R0361:Vmn2r28 UTSW 7 5493716 missense probably benign 0.00
R0396:Vmn2r28 UTSW 7 5488514 missense probably benign 0.05
R0480:Vmn2r28 UTSW 7 5490457 missense probably benign 0.00
R0485:Vmn2r28 UTSW 7 5488690 missense probably damaging 1.00
R0837:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R1296:Vmn2r28 UTSW 7 5481545 missense possibly damaging 0.81
R1829:Vmn2r28 UTSW 7 5493811 missense probably benign
R1853:Vmn2r28 UTSW 7 5481247 nonsense probably null
R1869:Vmn2r28 UTSW 7 5486346 missense probably benign 0.00
R1887:Vmn2r28 UTSW 7 5488289 missense possibly damaging 0.90
R1961:Vmn2r28 UTSW 7 5481071 missense possibly damaging 0.85
R1998:Vmn2r28 UTSW 7 5488314 missense possibly damaging 0.87
R2392:Vmn2r28 UTSW 7 5484131 missense probably damaging 0.98
R2432:Vmn2r28 UTSW 7 5488702 missense probably damaging 0.99
R3055:Vmn2r28 UTSW 7 5481392 missense probably damaging 0.98
R3753:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R3877:Vmn2r28 UTSW 7 5488358 missense probably damaging 1.00
R4307:Vmn2r28 UTSW 7 5490708 missense probably damaging 0.99
R5023:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5057:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5083:Vmn2r28 UTSW 7 5480672 missense possibly damaging 0.77
R5427:Vmn2r28 UTSW 7 5486377 missense probably damaging 0.99
R5472:Vmn2r28 UTSW 7 5487944 critical splice donor site probably null
R5511:Vmn2r28 UTSW 7 5484012 missense possibly damaging 0.61
R5731:Vmn2r28 UTSW 7 5488669 missense probably benign 0.41
R6091:Vmn2r28 UTSW 7 5493791 missense possibly damaging 0.88
R6179:Vmn2r28 UTSW 7 5488004 nonsense probably null
R6276:Vmn2r28 UTSW 7 5490731 missense probably benign 0.01
R6441:Vmn2r28 UTSW 7 5488475 missense probably benign 0.00
R6463:Vmn2r28 UTSW 7 5486436 missense probably benign 0.07
R6528:Vmn2r28 UTSW 7 5490685 missense probably benign 0.12
R6725:Vmn2r28 UTSW 7 5488409 missense probably benign 0.13
R6760:Vmn2r28 UTSW 7 5481230 missense probably damaging 0.97
R6849:Vmn2r28 UTSW 7 5480807 missense probably damaging 1.00
R7110:Vmn2r28 UTSW 7 5490734 missense probably benign 0.06
R7146:Vmn2r28 UTSW 7 5481496 missense probably benign 0.05
R7407:Vmn2r28 UTSW 7 5481309 missense probably damaging 1.00
R7563:Vmn2r28 UTSW 7 5488201 missense probably benign 0.00
R7611:Vmn2r28 UTSW 7 5481256 missense probably benign 0.02
R7808:Vmn2r28 UTSW 7 5493679 missense probably damaging 0.98
R7862:Vmn2r28 UTSW 7 5490614 missense probably benign 0.00
R7916:Vmn2r28 UTSW 7 5480819 missense probably damaging 1.00
R8183:Vmn2r28 UTSW 7 5488148 missense probably damaging 1.00
R8334:Vmn2r28 UTSW 7 5484060 missense probably damaging 1.00
R8519:Vmn2r28 UTSW 7 5486348 missense probably benign 0.31
R8989:Vmn2r28 UTSW 7 5490474 missense probably benign 0.00
R9066:Vmn2r28 UTSW 7 5488597 missense probably damaging 1.00
R9422:Vmn2r28 UTSW 7 5480748 missense not run
Predicted Primers PCR Primer
(F):5'- TGGCTTCATTGAATGCGTCAGGTAG -3'
(R):5'- GCAGAATTGCAAGGCTCCTTTCAAC -3'

Sequencing Primer
(F):5'- ATGCAGTAACTGAGCCCTTG -3'
(R):5'- TTGTCCAGAATACCAGTATGCC -3'
Posted On 2014-01-29