Mutagenetix > Incidental Mutations

Incidental Mutation 'R1282:Vmn2r28'

151057

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r28

Ensembl Gene

ENSMUSG00000066820

Gene Name

vomeronasal 2, receptor 28

Synonyms

EG665255

MMRRC Submission

039348-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R1282 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5479531-5493967 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5481302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 633 (M633K)

Ref Sequence

ENSEMBL: ENSMUSP00000083477 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086297]

AlphaFold

L7N203

Predicted Effect

probably damaging
Transcript: ENSMUST00000086297
AA Change: M633K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000083477
Gene: ENSMUSG00000066820
AA Change: M633K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	470	1.7e-26	PFAM
Pfam:NCD3G	512	565	9.8e-21	PFAM
Pfam:7tm_3	598	833	2.8e-56	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	T	6: 149,329,172	Q1239*	probably null	Het
Acmsd	T	C	1: 127,738,560	Y23H	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Atp2a2	G	T	5: 122,491,754	T84K	probably benign	Het
Cfap65	T	A	1: 74,925,104	T562S	probably benign	Het
Cyp2b10	G	A	7: 25,926,080	C436Y	probably damaging	Het
Dnajc7	T	C	11: 100,584,641	D381G	probably damaging	Het
Dnase1l3	T	C	14: 7,983,117	D129G	probably benign	Het
Espl1	A	G	15: 102,315,391	T1126A	probably benign	Het
Exoc3	T	C	13: 74,182,292	N506S	probably benign	Het
Fastkd3	C	A	13: 68,584,557	N332K	possibly damaging	Het
Fbxw15	G	A	9: 109,558,246	S227F	probably damaging	Het
Foxp4	G	A	17: 47,875,643	P404S	unknown	Het
Gjb3	G	A	4: 127,326,431	R103W	probably damaging	Het
Gm12789	T	A	4: 101,988,290	W59R	probably damaging	Het
Greb1l	T	A	18: 10,547,289	N1502K	probably benign	Het
H2-K1	A	C	17: 33,999,447	I165S	probably damaging	Het
Ipo9	A	G	1: 135,402,292	I470T	possibly damaging	Het
Kcnu1	A	T	8: 25,905,957	I657F	probably benign	Het
Lrp1b	A	T	2: 40,860,761	N2930K	probably damaging	Het
Olfr683	T	A	7: 105,143,652	I220F	probably benign	Het
Prag1	T	C	8: 36,099,914	V73A	probably damaging	Het
Prrc2b	T	C	2: 32,223,444	I1963T	probably damaging	Het
Rep15	C	T	6: 147,033,229	R189*	probably null	Het
Rtp3	T	C	9: 110,986,920	K188E	probably benign	Het
Scd2	T	C	19: 44,295,181	L101P	probably damaging	Het
Scn7a	A	T	2: 66,700,849	H561Q	probably damaging	Het
Sfr1	T	C	19: 47,732,968	S118P	probably damaging	Het
Slf1	C	T	13: 77,043,840	M958I	probably damaging	Het
Snrk	G	T	9: 122,160,520	R310L	possibly damaging	Het
Snx11	T	C	11: 96,773,161	Y35C	probably damaging	Het
Supt6	T	C	11: 78,228,768	T404A	possibly damaging	Het
Svep1	C	A	4: 58,100,032	L1337F	possibly damaging	Het
Traf3ip2	C	T	10: 39,626,405	T183M	probably damaging	Het
Vmn2r67	A	G	7: 85,136,724	V691A	probably benign	Het

Other mutations in Vmn2r28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Vmn2r28	APN	7	5488069	missense	probably benign	0.12
IGL01061:Vmn2r28	APN	7	5488184	missense	probably damaging	1.00
IGL01160:Vmn2r28	APN	7	5486478	missense	probably damaging	0.99
IGL01335:Vmn2r28	APN	7	5481088	missense	possibly damaging	0.67
IGL01532:Vmn2r28	APN	7	5486464	missense	probably benign	0.16
IGL01791:Vmn2r28	APN	7	5488162	missense	probably benign	0.00
IGL01875:Vmn2r28	APN	7	5481303	missense	probably benign	0.30
IGL02161:Vmn2r28	APN	7	5488124	missense	possibly damaging	0.88
IGL02499:Vmn2r28	APN	7	5490569	missense	probably damaging	0.98
IGL02858:Vmn2r28	APN	7	5481004	missense	probably damaging	0.99
IGL03061:Vmn2r28	APN	7	5484016	missense	probably damaging	0.98
G1patch:Vmn2r28	UTSW	7	5488409	missense	probably benign	0.13
R0288:Vmn2r28	UTSW	7	5488021	missense	probably damaging	1.00
R0361:Vmn2r28	UTSW	7	5493716	missense	probably benign	0.00
R0396:Vmn2r28	UTSW	7	5488514	missense	probably benign	0.05
R0480:Vmn2r28	UTSW	7	5490457	missense	probably benign	0.00
R0485:Vmn2r28	UTSW	7	5488690	missense	probably damaging	1.00
R0837:Vmn2r28	UTSW	7	5488027	missense	probably damaging	0.99
R1296:Vmn2r28	UTSW	7	5481545	missense	possibly damaging	0.81
R1829:Vmn2r28	UTSW	7	5493811	missense	probably benign
R1853:Vmn2r28	UTSW	7	5481247	nonsense	probably null
R1869:Vmn2r28	UTSW	7	5486346	missense	probably benign	0.00
R1887:Vmn2r28	UTSW	7	5488289	missense	possibly damaging	0.90
R1961:Vmn2r28	UTSW	7	5481071	missense	possibly damaging	0.85
R1998:Vmn2r28	UTSW	7	5488314	missense	possibly damaging	0.87
R2392:Vmn2r28	UTSW	7	5484131	missense	probably damaging	0.98
R2432:Vmn2r28	UTSW	7	5488702	missense	probably damaging	0.99
R3055:Vmn2r28	UTSW	7	5481392	missense	probably damaging	0.98
R3753:Vmn2r28	UTSW	7	5488027	missense	probably damaging	0.99
R3877:Vmn2r28	UTSW	7	5488358	missense	probably damaging	1.00
R4307:Vmn2r28	UTSW	7	5490708	missense	probably damaging	0.99
R5023:Vmn2r28	UTSW	7	5486464	missense	probably benign	0.16
R5057:Vmn2r28	UTSW	7	5486464	missense	probably benign	0.16
R5083:Vmn2r28	UTSW	7	5480672	missense	possibly damaging	0.77
R5427:Vmn2r28	UTSW	7	5486377	missense	probably damaging	0.99
R5472:Vmn2r28	UTSW	7	5487944	critical splice donor site	probably null
R5511:Vmn2r28	UTSW	7	5484012	missense	possibly damaging	0.61
R5731:Vmn2r28	UTSW	7	5488669	missense	probably benign	0.41
R6091:Vmn2r28	UTSW	7	5493791	missense	possibly damaging	0.88
R6179:Vmn2r28	UTSW	7	5488004	nonsense	probably null
R6276:Vmn2r28	UTSW	7	5490731	missense	probably benign	0.01
R6441:Vmn2r28	UTSW	7	5488475	missense	probably benign	0.00
R6463:Vmn2r28	UTSW	7	5486436	missense	probably benign	0.07
R6528:Vmn2r28	UTSW	7	5490685	missense	probably benign	0.12
R6725:Vmn2r28	UTSW	7	5488409	missense	probably benign	0.13
R6760:Vmn2r28	UTSW	7	5481230	missense	probably damaging	0.97
R6849:Vmn2r28	UTSW	7	5480807	missense	probably damaging	1.00
R7110:Vmn2r28	UTSW	7	5490734	missense	probably benign	0.06
R7146:Vmn2r28	UTSW	7	5481496	missense	probably benign	0.05
R7407:Vmn2r28	UTSW	7	5481309	missense	probably damaging	1.00
R7563:Vmn2r28	UTSW	7	5488201	missense	probably benign	0.00
R7611:Vmn2r28	UTSW	7	5481256	missense	probably benign	0.02
R7808:Vmn2r28	UTSW	7	5493679	missense	probably damaging	0.98
R7862:Vmn2r28	UTSW	7	5490614	missense	probably benign	0.00
R7916:Vmn2r28	UTSW	7	5480819	missense	probably damaging	1.00
R8183:Vmn2r28	UTSW	7	5488148	missense	probably damaging	1.00
R8334:Vmn2r28	UTSW	7	5484060	missense	probably damaging	1.00
R8519:Vmn2r28	UTSW	7	5486348	missense	probably benign	0.31
R8989:Vmn2r28	UTSW	7	5490474	missense	probably benign	0.00
R9066:Vmn2r28	UTSW	7	5488597	missense	probably damaging	1.00
R9422:Vmn2r28	UTSW	7	5480748	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGGCTTCATTGAATGCGTCAGGTAG -3'
(R):5'- GCAGAATTGCAAGGCTCCTTTCAAC -3'

Sequencing Primer
(F):5'- ATGCAGTAACTGAGCCCTTG -3'
(R):5'- TTGTCCAGAATACCAGTATGCC -3'

Posted On

2014-01-29