Incidental Mutation 'R1282:Cyp2b10'
ID 151058
Institutional Source Beutler Lab
Gene Symbol Cyp2b10
Ensembl Gene ENSMUSG00000030483
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 10
Synonyms phenobarbitol inducible, type b, p16, Cyp2b20, Cyp2b
MMRRC Submission 039348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R1282 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 25897620-25926624 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25926080 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 436 (C436Y)
Ref Sequence ENSEMBL: ENSMUSP00000072264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005477] [ENSMUST00000072438]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005477
AA Change: C445Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005477
Gene: ENSMUSG00000030483
AA Change: C445Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 497 4.1e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072438
AA Change: C436Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072264
Gene: ENSMUSG00000030483
AA Change: C436Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2e-152 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP2B6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize some xenobiotics, such as the anti-cancer drugs cyclophosphamide and ifosphamide. Transcript variants for this gene have been described; however, it has not been resolved whether these transcripts are in fact produced by this gene or by a closely related pseudogene, CYP2B7. Both the gene and the pseudogene are located in the middle of a CYP2A pseudogene found in a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,172 Q1239* probably null Het
Acmsd T C 1: 127,738,560 Y23H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp2a2 G T 5: 122,491,754 T84K probably benign Het
Cfap65 T A 1: 74,925,104 T562S probably benign Het
Dnajc7 T C 11: 100,584,641 D381G probably damaging Het
Dnase1l3 T C 14: 7,983,117 D129G probably benign Het
Espl1 A G 15: 102,315,391 T1126A probably benign Het
Exoc3 T C 13: 74,182,292 N506S probably benign Het
Fastkd3 C A 13: 68,584,557 N332K possibly damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxp4 G A 17: 47,875,643 P404S unknown Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm12789 T A 4: 101,988,290 W59R probably damaging Het
Greb1l T A 18: 10,547,289 N1502K probably benign Het
H2-K1 A C 17: 33,999,447 I165S probably damaging Het
Ipo9 A G 1: 135,402,292 I470T possibly damaging Het
Kcnu1 A T 8: 25,905,957 I657F probably benign Het
Lrp1b A T 2: 40,860,761 N2930K probably damaging Het
Olfr683 T A 7: 105,143,652 I220F probably benign Het
Prag1 T C 8: 36,099,914 V73A probably damaging Het
Prrc2b T C 2: 32,223,444 I1963T probably damaging Het
Rep15 C T 6: 147,033,229 R189* probably null Het
Rtp3 T C 9: 110,986,920 K188E probably benign Het
Scd2 T C 19: 44,295,181 L101P probably damaging Het
Scn7a A T 2: 66,700,849 H561Q probably damaging Het
Sfr1 T C 19: 47,732,968 S118P probably damaging Het
Slf1 C T 13: 77,043,840 M958I probably damaging Het
Snrk G T 9: 122,160,520 R310L possibly damaging Het
Snx11 T C 11: 96,773,161 Y35C probably damaging Het
Supt6 T C 11: 78,228,768 T404A possibly damaging Het
Svep1 C A 4: 58,100,032 L1337F possibly damaging Het
Traf3ip2 C T 10: 39,626,405 T183M probably damaging Het
Vmn2r28 A T 7: 5,481,302 M633K probably damaging Het
Vmn2r67 A G 7: 85,136,724 V691A probably benign Het
Other mutations in Cyp2b10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Cyp2b10 APN 7 25913937 missense probably damaging 0.99
IGL02341:Cyp2b10 APN 7 25911242 missense probably benign 0.33
IGL02557:Cyp2b10 APN 7 25914881 missense probably benign
R0038:Cyp2b10 UTSW 7 25914862 missense probably benign 0.21
R0393:Cyp2b10 UTSW 7 25914934 splice site probably benign
R0569:Cyp2b10 UTSW 7 25897735 missense probably damaging 1.00
R1035:Cyp2b10 UTSW 7 25917048 missense probably benign 0.34
R1262:Cyp2b10 UTSW 7 25915411 missense probably benign 0.16
R1452:Cyp2b10 UTSW 7 25925388 intron probably benign
R2163:Cyp2b10 UTSW 7 25925385 intron probably benign
R4520:Cyp2b10 UTSW 7 25911557 missense probably benign 0.05
R4831:Cyp2b10 UTSW 7 25915496 nonsense probably null
R5201:Cyp2b10 UTSW 7 25916994 missense probably damaging 1.00
R5330:Cyp2b10 UTSW 7 25913989 nonsense probably null
R5586:Cyp2b10 UTSW 7 25917012 missense probably damaging 1.00
R5964:Cyp2b10 UTSW 7 25926223 missense probably benign 0.28
R6043:Cyp2b10 UTSW 7 25917339 missense probably damaging 0.99
R6470:Cyp2b10 UTSW 7 25911656 missense possibly damaging 0.57
R6991:Cyp2b10 UTSW 7 25917355 missense probably benign 0.05
R7567:Cyp2b10 UTSW 7 25914779 missense probably damaging 1.00
R7847:Cyp2b10 UTSW 7 25897760 missense possibly damaging 0.52
R8131:Cyp2b10 UTSW 7 25914817 nonsense probably null
R8486:Cyp2b10 UTSW 7 25914881 missense probably benign
R8988:Cyp2b10 UTSW 7 25926245 missense probably damaging 1.00
R8992:Cyp2b10 UTSW 7 25925390 missense unknown
R9286:Cyp2b10 UTSW 7 25916966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAATTGTAGGGTGATGGTCAAAGTCC -3'
(R):5'- TGGAGCCCTGGAGATTTGGAGAC -3'

Sequencing Primer
(F):5'- TCAAAGTCCTTGTTGTTTAGTGC -3'
(R):5'- GCAATAGGAGTACTGATTTCCAGC -3'
Posted On 2014-01-29