Incidental Mutation 'R1282:Fastkd3'
ID151070
Institutional Source Beutler Lab
Gene Symbol Fastkd3
Ensembl Gene ENSMUSG00000021532
Gene NameFAST kinase domains 3
Synonyms2310010B21Rik
MMRRC Submission 039348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1282 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location68582234-68592338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68584557 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 332 (N332K)
Ref Sequence ENSEMBL: ENSMUSP00000152635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045827] [ENSMUST00000051784] [ENSMUST00000220973] [ENSMUST00000221259] [ENSMUST00000222107] [ENSMUST00000222631] [ENSMUST00000222660] [ENSMUST00000223101] [ENSMUST00000223187] [ENSMUST00000223319] [ENSMUST00000223398]
Predicted Effect probably benign
Transcript: ENSMUST00000045827
SMART Domains Protein: ENSMUSP00000039810
Gene: ENSMUSG00000034617

DomainStartEndE-ValueType
Pfam:Flavodoxin_5 5 126 2.7e-9 PFAM
Pfam:Flavodoxin_1 6 142 4.3e-32 PFAM
Pfam:FAD_binding_1 267 490 2.6e-51 PFAM
Pfam:NAD_binding_1 540 660 5.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000051784
AA Change: N332K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000061737
Gene: ENSMUSG00000021532
AA Change: N332K

DomainStartEndE-ValueType
low complexity region 178 189 N/A INTRINSIC
Pfam:FAST_1 410 478 2.9e-22 PFAM
Pfam:FAST_2 491 581 3.1e-28 PFAM
RAP 594 651 7.58e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221006
Predicted Effect probably benign
Transcript: ENSMUST00000221259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222068
Predicted Effect probably benign
Transcript: ENSMUST00000222107
Predicted Effect probably benign
Transcript: ENSMUST00000222631
Predicted Effect probably benign
Transcript: ENSMUST00000222660
Predicted Effect probably benign
Transcript: ENSMUST00000222685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223055
Predicted Effect probably benign
Transcript: ENSMUST00000223101
Predicted Effect probably benign
Transcript: ENSMUST00000223187
Predicted Effect possibly damaging
Transcript: ENSMUST00000223319
AA Change: N332K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000223398
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of Fas-activated serine/threonine kinase domain (FASTKD) containing proteins that share an amino terminal mitochondrial targeting domain and multiple carboxy terminal FAST domains as well as a putative RNA-binding RAP domain. The members of this family are ubiquitously expressed and are generally most abundant in mitochondria-enriched tissues such as heart, skeletal muscle and brown-adipose tissue. Some members of this protein family may play a role in apoptosis. The protein encoded by this gene interacts with components of the mitochondrial respiratory and translation networks. A pseudogene of this gene is also present on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,172 Q1239* probably null Het
Acmsd T C 1: 127,738,560 Y23H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp2a2 G T 5: 122,491,754 T84K probably benign Het
Cfap65 T A 1: 74,925,104 T562S probably benign Het
Cyp2b10 G A 7: 25,926,080 C436Y probably damaging Het
Dnajc7 T C 11: 100,584,641 D381G probably damaging Het
Dnase1l3 T C 14: 7,983,117 D129G probably benign Het
Espl1 A G 15: 102,315,391 T1126A probably benign Het
Exoc3 T C 13: 74,182,292 N506S probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxp4 G A 17: 47,875,643 P404S unknown Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm12789 T A 4: 101,988,290 W59R probably damaging Het
Greb1l T A 18: 10,547,289 N1502K probably benign Het
H2-K1 A C 17: 33,999,447 I165S probably damaging Het
Ipo9 A G 1: 135,402,292 I470T possibly damaging Het
Kcnu1 A T 8: 25,905,957 I657F probably benign Het
Lrp1b A T 2: 40,860,761 N2930K probably damaging Het
Olfr683 T A 7: 105,143,652 I220F probably benign Het
Prag1 T C 8: 36,099,914 V73A probably damaging Het
Prrc2b T C 2: 32,223,444 I1963T probably damaging Het
Rep15 C T 6: 147,033,229 R189* probably null Het
Rtp3 T C 9: 110,986,920 K188E probably benign Het
Scd2 T C 19: 44,295,181 L101P probably damaging Het
Scn7a A T 2: 66,700,849 H561Q probably damaging Het
Sfr1 T C 19: 47,732,968 S118P probably damaging Het
Slf1 C T 13: 77,043,840 M958I probably damaging Het
Snrk G T 9: 122,160,520 R310L possibly damaging Het
Snx11 T C 11: 96,773,161 Y35C probably damaging Het
Supt6 T C 11: 78,228,768 T404A possibly damaging Het
Svep1 C A 4: 58,100,032 L1337F possibly damaging Het
Traf3ip2 C T 10: 39,626,405 T183M probably damaging Het
Vmn2r28 A T 7: 5,481,302 M633K probably damaging Het
Vmn2r67 A G 7: 85,136,724 V691A probably benign Het
Other mutations in Fastkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Fastkd3 APN 13 68584528 missense possibly damaging 0.87
IGL01839:Fastkd3 APN 13 68584852 missense probably benign 0.19
IGL02268:Fastkd3 APN 13 68583677 missense probably damaging 0.96
IGL03412:Fastkd3 APN 13 68583721 missense probably benign 0.01
R0681:Fastkd3 UTSW 13 68591928 splice site probably benign
R1987:Fastkd3 UTSW 13 68585241 missense possibly damaging 0.92
R3081:Fastkd3 UTSW 13 68584868 missense probably benign 0.38
R4153:Fastkd3 UTSW 13 68590138 missense probably damaging 1.00
R5339:Fastkd3 UTSW 13 68590164 missense probably damaging 1.00
R5384:Fastkd3 UTSW 13 68584585 missense probably benign 0.09
R6034:Fastkd3 UTSW 13 68583610 missense probably damaging 0.99
R6034:Fastkd3 UTSW 13 68583610 missense probably damaging 0.99
R6109:Fastkd3 UTSW 13 68590218 nonsense probably null
R6123:Fastkd3 UTSW 13 68590218 nonsense probably null
R6124:Fastkd3 UTSW 13 68590218 nonsense probably null
R6299:Fastkd3 UTSW 13 68587736 missense probably damaging 0.97
R6388:Fastkd3 UTSW 13 68590200 missense probably damaging 1.00
R6561:Fastkd3 UTSW 13 68584030 missense possibly damaging 0.95
R7214:Fastkd3 UTSW 13 68589380 missense probably benign 0.12
R7446:Fastkd3 UTSW 13 68591960 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTCAAGGTGCGAGTTGTGAGAC -3'
(R):5'- ACTGGCAAACAACGATCTCTGAGAC -3'

Sequencing Primer
(F):5'- TTTGCTCCAGAGGAGATCAC -3'
(R):5'- CGATCTCTGAGACTACGTCGAAG -3'
Posted On2014-01-29