Incidental Mutation 'R1264:Pard3b'
ID151101
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Namepar-3 family cell polarity regulator beta
SynonymsPAR3beta, 1810008K04Rik, 2810455B10Rik, PAR3B, 2010002N16Rik, Als2cr19, PAR3L
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location61638824-62642284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62164157 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 415 (I415F)
Ref Sequence ENSEMBL: ENSMUSP00000092510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
Predicted Effect probably damaging
Transcript: ENSMUST00000046673
AA Change: I415F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: I415F

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075374
AA Change: I415F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: I415F

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094906
AA Change: I415F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: I415F

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188325
Meta Mutation Damage Score 0.8399 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62161198 missense probably damaging 0.99
IGL01363:Pard3b APN 1 62637640 missense probably damaging 1.00
IGL01509:Pard3b APN 1 62161248 missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62637862 missense probably damaging 0.96
IGL01651:Pard3b APN 1 62479804 intron probably benign
IGL01670:Pard3b APN 1 62211648 missense probably damaging 1.00
IGL02156:Pard3b APN 1 61767950 missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62166382 missense probably damaging 1.00
IGL02450:Pard3b APN 1 62532676 missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62198771 splice site probably benign
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0060:Pard3b UTSW 1 61639315 missense probably damaging 0.97
R0157:Pard3b UTSW 1 62211633 missense probably damaging 0.96
R0333:Pard3b UTSW 1 62230212 missense probably benign 0.00
R0448:Pard3b UTSW 1 62166469 missense probably damaging 1.00
R0465:Pard3b UTSW 1 62211718 splice site probably benign
R0497:Pard3b UTSW 1 62440008 splice site probably null
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1482:Pard3b UTSW 1 62166367 missense probably damaging 1.00
R1554:Pard3b UTSW 1 62637894 missense probably damaging 0.97
R1836:Pard3b UTSW 1 62637604 missense probably benign 0.03
R2005:Pard3b UTSW 1 62144891 missense probably benign 0.12
R2220:Pard3b UTSW 1 62479683 nonsense probably null
R2435:Pard3b UTSW 1 62587738 missense probably damaging 1.00
R3015:Pard3b UTSW 1 62344878 missense probably damaging 1.00
R3688:Pard3b UTSW 1 62479569 missense probably benign
R3712:Pard3b UTSW 1 62343978 missense probably damaging 1.00
R3799:Pard3b UTSW 1 62161229 missense probably benign 0.06
R3942:Pard3b UTSW 1 62159452 missense probably damaging 1.00
R4683:Pard3b UTSW 1 62216516 missense probably benign
R4729:Pard3b UTSW 1 62211684 missense probably damaging 1.00
R4898:Pard3b UTSW 1 61768000 missense probably damaging 1.00
R4981:Pard3b UTSW 1 62344060 missense probably damaging 1.00
R5049:Pard3b UTSW 1 62161161 missense probably benign 0.01
R5223:Pard3b UTSW 1 62344113 missense probably damaging 1.00
R5476:Pard3b UTSW 1 62010406 missense probably benign 0.10
R5541:Pard3b UTSW 1 61639343 missense probably damaging 1.00
R5672:Pard3b UTSW 1 62010466 missense probably benign 0.11
R5714:Pard3b UTSW 1 62637916 missense probably null 0.99
R5722:Pard3b UTSW 1 62440001 splice site probably null
R5793:Pard3b UTSW 1 61767973 missense probably damaging 1.00
R5930:Pard3b UTSW 1 61768130 intron probably benign
R5950:Pard3b UTSW 1 62216531 missense probably benign 0.04
R5997:Pard3b UTSW 1 62076409 missense probably damaging 1.00
R6646:Pard3b UTSW 1 62161121 missense probably benign 0.32
R6720:Pard3b UTSW 1 62159470 missense probably damaging 0.99
R6809:Pard3b UTSW 1 62161181 missense probably damaging 1.00
R7148:Pard3b UTSW 1 62440032 missense probably benign 0.01
R7847:Pard3b UTSW 1 62343934 missense probably benign 0.00
R7879:Pard3b UTSW 1 62159511 missense possibly damaging 0.65
R7930:Pard3b UTSW 1 62343934 missense probably benign 0.00
R7936:Pard3b UTSW 1 61767945 splice site probably null
R7962:Pard3b UTSW 1 62159511 missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62153989 missense probably damaging 1.00
R8125:Pard3b UTSW 1 61767984 missense probably damaging 1.00
Z1176:Pard3b UTSW 1 62238892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCACCTGCTTGGGAGGGAAGATG -3'
(R):5'- TTTGGGGATGGCAGTGGGACCAAC -3'

Sequencing Primer
(F):5'- ACTGTGGAATCAATACTCTGGGC -3'
(R):5'- CAAGGGATAGCAACGGACTACTAC -3'
Posted On2014-01-29