Incidental Mutation 'R1264:Col4a3'
ID151103
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Namecollagen, type IV, alpha 3
Synonymsalpha3(IV), tumstatin
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location82586921-82722059 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 82643301 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457]
Predicted Effect probably benign
Transcript: ENSMUST00000113457
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141994
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82697754 missense unknown
IGL00847:Col4a3 APN 1 82717869 missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82682301 missense unknown
IGL01102:Col4a3 APN 1 82669720 missense unknown
IGL01102:Col4a3 APN 1 82670255 missense unknown
IGL02071:Col4a3 APN 1 82660887 critical splice donor site probably null
IGL02244:Col4a3 APN 1 82669771 splice site probably benign
IGL02380:Col4a3 APN 1 82672788 splice site probably benign
IGL02431:Col4a3 APN 1 82679623 nonsense probably null
IGL02466:Col4a3 APN 1 82670192 missense unknown
IGL02694:Col4a3 APN 1 82710794 unclassified probably benign
IGL02709:Col4a3 APN 1 82679112 missense unknown
IGL02752:Col4a3 APN 1 82660225 missense unknown
IGL02792:Col4a3 APN 1 82718803 missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82672639 nonsense probably null
IGL03218:Col4a3 APN 1 82643206 splice site probably benign
FR4976:Col4a3 UTSW 1 82718906 frame shift probably null
PIT4260001:Col4a3 UTSW 1 82682761 missense unknown
PIT4515001:Col4a3 UTSW 1 82682303 missense unknown
R0035:Col4a3 UTSW 1 82672753 missense unknown
R0099:Col4a3 UTSW 1 82717993 missense probably benign 0.41
R0433:Col4a3 UTSW 1 82670219 missense unknown
R0573:Col4a3 UTSW 1 82716363 missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82672586 splice site probably benign
R0715:Col4a3 UTSW 1 82652158 splice site probably benign
R0961:Col4a3 UTSW 1 82708576 splice site probably benign
R1257:Col4a3 UTSW 1 82716365 missense probably damaging 1.00
R1373:Col4a3 UTSW 1 82690087 splice site probably benign
R1694:Col4a3 UTSW 1 82690663 splice site probably null
R1895:Col4a3 UTSW 1 82679108 missense unknown
R1925:Col4a3 UTSW 1 82700373 missense unknown
R1925:Col4a3 UTSW 1 82711874 unclassified probably benign
R2033:Col4a3 UTSW 1 82718011 intron probably benign
R2044:Col4a3 UTSW 1 82696319 missense unknown
R2122:Col4a3 UTSW 1 82654957 missense unknown
R2282:Col4a3 UTSW 1 82708638 missense unknown
R2318:Col4a3 UTSW 1 82648569 splice site probably null
R2421:Col4a3 UTSW 1 82670275 splice site probably benign
R2517:Col4a3 UTSW 1 82680710 missense unknown
R2965:Col4a3 UTSW 1 82648600 missense unknown
R3085:Col4a3 UTSW 1 82651258 missense unknown
R3150:Col4a3 UTSW 1 82657137 splice site probably null
R3947:Col4a3 UTSW 1 82715332 missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82716297 critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82672679 missense unknown
R4928:Col4a3 UTSW 1 82710977 unclassified probably benign
R5044:Col4a3 UTSW 1 82666546 missense unknown
R5557:Col4a3 UTSW 1 82715247 unclassified probably benign
R5761:Col4a3 UTSW 1 82716057 nonsense probably null
R5970:Col4a3 UTSW 1 82716329 missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82708574 intron probably null
R6583:Col4a3 UTSW 1 82641476 missense unknown
R6675:Col4a3 UTSW 1 82668925 missense unknown
R7170:Col4a3 UTSW 1 82715909 intron probably null
R7592:Col4a3 UTSW 1 82648617 missense unknown
R7624:Col4a3 UTSW 1 82718884 missense probably benign
R8127:Col4a3 UTSW 1 82649760 missense unknown
X0067:Col4a3 UTSW 1 82716159 missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82690039 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTGAGTGCTAACTAGTGACCCC -3'
(R):5'- GTTGTGTGCCAGCAAACCTTGTATG -3'

Sequencing Primer
(F):5'- GCTAACTAGTGACCCCTTGATG -3'
(R):5'- CCCCCCATGTAAGAGGTGTTTG -3'
Posted On2014-01-29