Mutagenetix > Incidental Mutation

Incidental Mutation 'R1264:Rapgef4'

151104

Institutional Source

Beutler Lab

Gene Symbol

Rapgef4

Ensembl Gene

ENSMUSG00000049044

Gene Name

Rap guanine nucleotide exchange factor (GEF) 4

Synonyms

cAMP-GEFII, Epac2, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik

MMRRC Submission

039331-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.683) question?

Stock #

R1264 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71981240-72257474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72031105 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 46 (K46N)

Ref Sequence

ENSEMBL: ENSMUSP00000099759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090826] [ENSMUST00000102698]

AlphaFold

Q9EQZ6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090826
AA Change: K46N

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044
AA Change: K46N

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	216	291	3.43e-27	SMART
low complexity region	302	311	N/A	INTRINSIC
cNMP	356	475	4.02e-15	SMART
RasGEFN	495	630	3.61e-7	SMART
Blast:RasGEF	678	751	2e-33	BLAST
RasGEF	768	1010	8.09e-105	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102698
AA Change: K46N

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044
AA Change: K46N

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	198	273	3.43e-27	SMART
low complexity region	284	293	N/A	INTRINSIC
cNMP	338	457	4.02e-15	SMART
RasGEFN	477	612	3.61e-7	SMART
Blast:RasGEF	660	733	2e-33	BLAST
RasGEF	750	992	8.09e-105	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149421

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150234

Meta Mutation Damage Score

0.0710

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (35/35)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin granule fusion in pancreatic islet cells during the first phase of cAMP-dependent insulin granule exocytosis. Mice homozygous for a knock-out allele exhibit impaired isoproterenol-induced SR calcium leak and arrhythmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	T	C	6: 142,646,377		probably benign	Het
Acadl	A	T	1: 66,857,553	C27S	probably benign	Het
Adgrb3	C	T	1: 25,559,850	G258E	probably damaging	Het
Akna	T	C	4: 63,381,725		probably null	Het
Angpt2	T	C	8: 18,741,217	N21S	probably benign	Het
Ano6	A	G	15: 95,949,566	Y585C	probably damaging	Het
Ascc3	A	T	10: 50,642,519		probably benign	Het
Clec10a	T	A	11: 70,169,741	S103T	possibly damaging	Het
Clstn2	T	C	9: 97,457,609	R770G	probably benign	Het
Cndp2	C	A	18: 84,678,791	C95F	possibly damaging	Het
Col12a1	A	G	9: 79,620,089	V2653A	probably benign	Het
Col4a3	A	T	1: 82,643,301		probably benign	Het
Daam1	A	G	12: 71,975,311		probably benign	Het
H2-M9	A	G	17: 36,642,592	V18A	probably benign	Het
Heatr1	T	A	13: 12,424,610		probably benign	Het
Impg1	T	C	9: 80,314,393	D715G	probably benign	Het
Incenp	T	C	19: 9,884,015	K425E	unknown	Het
Kif13b	T	C	14: 64,776,232		probably benign	Het
Msh2	T	A	17: 87,707,179		probably null	Het
Myh2	A	G	11: 67,180,778	N474D	probably damaging	Het
Myo18b	T	C	5: 112,830,319	T1246A	probably benign	Het
Nob1	T	C	8: 107,421,504	H102R	probably damaging	Het
Olfr1427	G	T	19: 12,098,834	D268E	probably benign	Het
Pard3b	A	T	1: 62,164,157	I415F	probably damaging	Het
Pfkl	T	G	10: 77,993,416	K386T	possibly damaging	Het
Plekhs1	T	C	19: 56,485,763	V447A	probably benign	Het
Poli	C	T	18: 70,517,503	V266I	probably benign	Het
Shisa6	T	C	11: 66,375,149		probably benign	Het
Six3	T	A	17: 85,621,857	D206E	probably damaging	Het
Slc12a1	A	T	2: 125,218,238	E944D	possibly damaging	Het
Sptb	A	G	12: 76,612,607	F1173S	probably damaging	Het
Tfdp1	C	A	8: 13,373,837		probably benign	Het
Trrap	A	G	5: 144,789,599		probably benign	Het
Wbp11	A	G	6: 136,814,515		probably benign	Het

Other mutations in Rapgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rapgef4	APN	2	72256312	missense	possibly damaging	0.75
IGL00858:Rapgef4	APN	2	72198897	missense	probably damaging	1.00
IGL01408:Rapgef4	APN	2	72174841	nonsense	probably null
IGL01673:Rapgef4	APN	2	72241437	missense	probably damaging	0.99
IGL01678:Rapgef4	APN	2	72242225	splice site	probably benign
IGL01725:Rapgef4	APN	2	72174874	missense	probably benign	0.24
IGL01871:Rapgef4	APN	2	72198360	missense	possibly damaging	0.69
IGL01935:Rapgef4	APN	2	72234123	missense	probably benign	0.05
IGL02001:Rapgef4	APN	2	72225052	splice site	probably benign
IGL02041:Rapgef4	APN	2	72198796	missense	probably damaging	1.00
IGL02134:Rapgef4	APN	2	72180061	missense	probably damaging	0.97
IGL02410:Rapgef4	APN	2	72226594	missense	possibly damaging	0.51
IGL02807:Rapgef4	APN	2	72205649	splice site	probably benign
IGL03066:Rapgef4	APN	2	72141179	splice site	probably benign
IGL03282:Rapgef4	APN	2	72205752	splice site	probably benign
IGL03291:Rapgef4	APN	2	72195703	missense	probably damaging	1.00
P0033:Rapgef4	UTSW	2	72137331	intron	probably benign
R0045:Rapgef4	UTSW	2	72198778	missense	possibly damaging	0.80
R0045:Rapgef4	UTSW	2	72198778	missense	possibly damaging	0.80
R0309:Rapgef4	UTSW	2	72226030	missense	probably benign	0.02
R0398:Rapgef4	UTSW	2	72031041	missense	probably damaging	0.99
R0747:Rapgef4	UTSW	2	72223073	missense	possibly damaging	0.66
R1216:Rapgef4	UTSW	2	72208148	missense	possibly damaging	0.51
R1302:Rapgef4	UTSW	2	72045160	missense	probably benign	0.31
R1460:Rapgef4	UTSW	2	72031176	critical splice donor site	probably null
R1483:Rapgef4	UTSW	2	72055026	critical splice donor site	probably null
R1682:Rapgef4	UTSW	2	72226568	missense	possibly damaging	0.80
R1768:Rapgef4	UTSW	2	72225787	splice site	probably benign
R1858:Rapgef4	UTSW	2	72031064	missense	possibly damaging	0.67
R1860:Rapgef4	UTSW	2	72234720	missense	probably benign	0.05
R1952:Rapgef4	UTSW	2	72208127	missense	probably benign	0.07
R2025:Rapgef4	UTSW	2	72242739	missense	probably benign	0.01
R2128:Rapgef4	UTSW	2	72226553	missense	possibly damaging	0.87
R2159:Rapgef4	UTSW	2	72174881	missense	probably damaging	1.00
R2201:Rapgef4	UTSW	2	72045189	missense	probably damaging	0.96
R2883:Rapgef4	UTSW	2	72031125	missense	probably benign
R3015:Rapgef4	UTSW	2	72198373	missense	probably damaging	1.00
R4278:Rapgef4	UTSW	2	72198395	missense	possibly damaging	0.95
R5256:Rapgef4	UTSW	2	72034034	missense	probably damaging	0.97
R5572:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5574:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5575:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5749:Rapgef4	UTSW	2	72242757	missense	probably damaging	1.00
R6007:Rapgef4	UTSW	2	72179949	missense	possibly damaging	0.55
R6084:Rapgef4	UTSW	2	72196278	critical splice donor site	probably null
R6192:Rapgef4	UTSW	2	71981317	missense	probably benign	0.00
R6409:Rapgef4	UTSW	2	72178237	missense	probably benign	0.01
R6683:Rapgef4	UTSW	2	72054779	intron	probably benign
R6774:Rapgef4	UTSW	2	72225775	missense	probably benign	0.01
R6844:Rapgef4	UTSW	2	72234626	missense	probably damaging	0.99
R6999:Rapgef4	UTSW	2	72239125	missense	probably damaging	1.00
R7077:Rapgef4	UTSW	2	72241476	missense	probably damaging	0.96
R7138:Rapgef4	UTSW	2	72198363	missense	probably damaging	1.00
R7275:Rapgef4	UTSW	2	72208101	missense	probably damaging	1.00
R7352:Rapgef4	UTSW	2	72180091	missense	probably damaging	1.00
R7397:Rapgef4	UTSW	2	72205666	missense	probably benign	0.23
R7508:Rapgef4	UTSW	2	72205733	missense	probably benign	0.00
R7620:Rapgef4	UTSW	2	72229078	missense	probably damaging	0.99
R7703:Rapgef4	UTSW	2	72179971	missense	probably benign	0.28
R7770:Rapgef4	UTSW	2	72198395	missense	possibly damaging	0.95
R7814:Rapgef4	UTSW	2	72223117	missense	probably benign
R7868:Rapgef4	UTSW	2	72201137	missense	probably benign	0.11
R8210:Rapgef4	UTSW	2	72226020	missense	probably benign	0.00
R8967:Rapgef4	UTSW	2	72226510	missense	possibly damaging	0.72
R9113:Rapgef4	UTSW	2	72031149	missense	probably benign	0.43
R9157:Rapgef4	UTSW	2	72174868	missense	probably benign	0.06
R9314:Rapgef4	UTSW	2	72234639	missense	possibly damaging	0.52
X0062:Rapgef4	UTSW	2	72226607	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CCACACCTTTGCTGTGGGGATTATC -3'
(R):5'- ACTTGGACACCCAAATATCTGGCAC -3'

Sequencing Primer
(F):5'- tgtggggtagacggagg -3'
(R):5'- AATATCTGGCACCAGACTCTGTG -3'

Posted On

2014-01-29