Incidental Mutation 'R1264:Nob1'
ID151112
Institutional Source Beutler Lab
Gene Symbol Nob1
Ensembl Gene ENSMUSG00000003848
Gene NameNIN1/RPN12 binding protein 1 homolog
SynonymsART-4, Nob1p, Psmd8bp1, 1700021I09Rik
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location107412486-107425051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107421504 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 102 (H102R)
Ref Sequence ENSEMBL: ENSMUSP00000003946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003946] [ENSMUST00000169311]
PDB Structure
Solution Structure of RSGI RUH-035, a Zn-ribbon module in Mouse cDNA [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000003946
AA Change: H102R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003946
Gene: ENSMUSG00000003848
AA Change: H102R

DomainStartEndE-ValueType
PINc 5 108 2.28e-6 SMART
Pfam:AF1Q 135 211 1.8e-30 PFAM
Pfam:NOB1_Zn_bind 251 323 1e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000076585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163973
Predicted Effect probably benign
Transcript: ENSMUST00000165266
SMART Domains Protein: ENSMUSP00000129298
Gene: ENSMUSG00000003848

DomainStartEndE-ValueType
Blast:PINc 5 61 9e-34 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169311
AA Change: H102R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126868
Gene: ENSMUSG00000003848
AA Change: H102R

DomainStartEndE-ValueType
PINc 5 108 2.28e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170796
Meta Mutation Damage Score 0.1026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In yeast, over 200 protein and RNA cofactors are required for ribosome assembly, and these are generally conserved in eukaryotes. These factors orchestrate modification and cleavage of the initial 35S precursor rRNA transcript into the mature 18S, 5.8S, and 25S rRNAs, folding of the rRNA, and binding of ribosomal proteins and 5S RNA. Nob1 is involved in pre-rRNA processing. In a late cytoplasmic processing step, Nob1 cleaves a 20S rRNA intermediate at cleavage site D to produce the mature 18S rRNA (Lamanna and Karbstein, 2009 [PubMed 19706509]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Nob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Nob1 APN 8 107424728 splice site probably benign
IGL01661:Nob1 APN 8 107413182 missense probably damaging 1.00
IGL02110:Nob1 APN 8 107416172 makesense probably null
IGL03373:Nob1 APN 8 107418046 intron probably benign
PIT4531001:Nob1 UTSW 8 107418417 missense probably benign 0.01
R0627:Nob1 UTSW 8 107416224 missense probably damaging 1.00
R1181:Nob1 UTSW 8 107421490 missense probably damaging 1.00
R2257:Nob1 UTSW 8 107417097 intron probably benign
R4402:Nob1 UTSW 8 107418488 intron probably benign
R5330:Nob1 UTSW 8 107416249 missense probably damaging 1.00
R6907:Nob1 UTSW 8 107416228 missense possibly damaging 0.90
R7702:Nob1 UTSW 8 107413105 nonsense probably null
X0017:Nob1 UTSW 8 107424833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCACCAAGGCCACTCTAATATTC -3'
(R):5'- TCCAAGGACTTGTCAGTTTGCCC -3'

Sequencing Primer
(F):5'- gtcccactcccagcacc -3'
(R):5'- CTTGTCAGTTTGCCCTTAACTAAAG -3'
Posted On2014-01-29