Incidental Mutation 'R1264:Shisa6'
ID151118
Institutional Source Beutler Lab
Gene Symbol Shisa6
Ensembl Gene ENSMUSG00000053930
Gene Nameshisa family member 6
SynonymsGm879, LOC380702
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location66211725-66525964 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 66375149 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000066679]
Predicted Effect probably benign
Transcript: ENSMUST00000066679
SMART Domains Protein: ENSMUSP00000071025
Gene: ENSMUSG00000053930

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 42 59 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Pfam:Shisa 97 294 6.3e-43 PFAM
low complexity region 378 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123454
SMART Domains Protein: ENSMUSP00000120862
Gene: ENSMUSG00000053930

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
Pfam:Shisa 41 227 2.4e-43 PFAM
low complexity region 354 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134562
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Shisa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Shisa6 APN 11 66217828 missense possibly damaging 0.94
IGL01620:Shisa6 APN 11 66217879 missense probably benign 0.03
IGL02702:Shisa6 APN 11 66219962 missense probably damaging 1.00
IGL02810:Shisa6 APN 11 66224948 missense possibly damaging 0.64
IGL03029:Shisa6 APN 11 66218013 missense probably damaging 1.00
R0363:Shisa6 UTSW 11 66525327 missense probably benign 0.17
R1220:Shisa6 UTSW 11 66220010 missense probably damaging 1.00
R2495:Shisa6 UTSW 11 66217633 missense probably damaging 1.00
R3962:Shisa6 UTSW 11 66217476 missense probably damaging 1.00
R4449:Shisa6 UTSW 11 66525418 missense probably benign 0.18
R5872:Shisa6 UTSW 11 66217974 missense probably damaging 1.00
R6059:Shisa6 UTSW 11 66224974 missense probably damaging 0.98
R6172:Shisa6 UTSW 11 66218006 missense probably benign 0.28
R6849:Shisa6 UTSW 11 66525501 missense probably benign 0.01
R6903:Shisa6 UTSW 11 66375156 splice site probably null
R7282:Shisa6 UTSW 11 66502654 missense possibly damaging 0.94
R7450:Shisa6 UTSW 11 66218006 missense probably benign 0.28
RF008:Shisa6 UTSW 11 66525923 unclassified probably benign
Z1176:Shisa6 UTSW 11 66375227 missense
Predicted Primers PCR Primer
(F):5'- GTGTCCCATCATGTACAGAGCAGG -3'
(R):5'- GCACACCATCATTGTTGGGCAAG -3'

Sequencing Primer
(F):5'- GAGGTCTTTTGCCTTCTAAAGTC -3'
(R):5'- CATCATTGTTGGGCAAGATGGAG -3'
Posted On2014-01-29