Mutagenetix > Incidental Mutation

Incidental Mutation 'R1265:Ppip5k2'

151135

Institutional Source

Beutler Lab

Gene Symbol

Ppip5k2

Ensembl Gene

ENSMUSG00000040648

Gene Name

diphosphoinositol pentakisphosphate kinase 2

Synonyms

Hisppd1, Cfap160, Vip2

MMRRC Submission

039332-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.231) question?

Stock #

R1265 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97633773-97698136 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97647625 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 976 (S976P)

Ref Sequence

ENSEMBL: ENSMUSP00000132889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042509] [ENSMUST00000112845] [ENSMUST00000171129]

AlphaFold

Q6ZQB6

Predicted Effect

probably benign
Transcript: ENSMUST00000042509
AA Change: S982P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000043401
Gene: ENSMUSG00000040648
AA Change: S982P

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
PDB:4NZO\|A	42	366	N/A	PDB
Pfam:His_Phos_2	379	894	2.9e-112	PFAM
low complexity region	1073	1092	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112845
AA Change: S1034P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000108466
Gene: ENSMUSG00000040648
AA Change: S1034P

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
PDB:4NZO\|A	42	366	N/A	PDB
Pfam:His_Phos_2	379	894	6.9e-141	PFAM
low complexity region	993	1006	N/A	INTRINSIC
low complexity region	1192	1211	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137758

Predicted Effect

probably benign
Transcript: ENSMUST00000171129
AA Change: S976P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000132889
Gene: ENSMUSG00000040648
AA Change: S976P

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
PDB:4NZO\|A	42	366	N/A	PDB
Pfam:His_Phos_2	379	894	2.9e-112	PFAM
low complexity region	1073	1092	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189992

Predicted Effect

probably benign
Transcript: ENSMUST00000191556

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine acid phosphatase family of proteins. Despite containing a histidine acid phosphatase domain, the encoded protein functions as an inositol pyrophosphate kinase, and is thought to lack phosphatase activity. This kinase activity is the mechanism by which the encoded protein synthesizes high-energy inositol pyrophosphates, which act as signaling molecules that regulate cellular homeostasis and other processes. This gene may be associated with autism spectrum disorder in human patients. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi1	T	C	2: 22,836,734 (GRCm39)	D316G	possibly damaging	Het
Aebp1	T	C	11: 5,821,740 (GRCm39)	V713A	probably damaging	Het
Alg2	T	C	4: 47,474,289 (GRCm39)		probably benign	Het
Ank1	T	A	8: 23,607,053 (GRCm39)	V1273E	possibly damaging	Het
Cntnap5a	A	G	1: 116,356,248 (GRCm39)	T760A	possibly damaging	Het
Fam120a	G	T	13: 49,039,219 (GRCm39)	A979E	possibly damaging	Het
Igf2r	A	T	17: 12,913,011 (GRCm39)	V1779E	probably damaging	Het
Lrp1b	C	T	2: 41,366,666 (GRCm39)	V537M	probably damaging	Het
Ltbp1	A	G	17: 75,532,280 (GRCm39)	Q118R	possibly damaging	Het
Ly6h	T	A	15: 75,438,032 (GRCm39)	M27L	probably benign	Het
Nphs2	A	G	1: 156,146,317 (GRCm39)	T173A	probably damaging	Het
Nsd3	T	C	8: 26,172,578 (GRCm39)	V779A	probably benign	Het
Or3a1d	T	C	11: 74,237,766 (GRCm39)	I95V	probably benign	Het
Pdzd7	T	C	19: 45,029,124 (GRCm39)	D82G	possibly damaging	Het
Pkp2	A	G	16: 16,043,168 (GRCm39)	N76S	probably benign	Het
Slc38a3	A	G	9: 107,529,185 (GRCm39)	F489S	probably damaging	Het
Sox11	T	C	12: 27,391,735 (GRCm39)	T225A	probably benign	Het
Tbx10	T	C	19: 4,046,625 (GRCm39)	F35S	probably damaging	Het
Tcf4	T	C	18: 69,776,003 (GRCm39)	M40T	possibly damaging	Het
Tenm2	C	T	11: 35,954,004 (GRCm39)	G1236R	possibly damaging	Het
Thsd7a	T	C	6: 12,317,418 (GRCm39)	N1630S	probably damaging	Het
Urb2	A	G	8: 124,751,892 (GRCm39)	D75G	probably damaging	Het

Other mutations in Ppip5k2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01927:Ppip5k2	APN	1	97,640,848 (GRCm39)	missense	probably damaging	1.00
IGL02266:Ppip5k2	APN	1	97,661,697 (GRCm39)	missense	possibly damaging	0.68
IGL02705:Ppip5k2	APN	1	97,686,924 (GRCm39)	missense	probably damaging	1.00
IGL03229:Ppip5k2	APN	1	97,656,686 (GRCm39)	missense	probably damaging	1.00
P0033:Ppip5k2	UTSW	1	97,645,253 (GRCm39)	missense	probably damaging	0.98
R0082:Ppip5k2	UTSW	1	97,687,057 (GRCm39)	nonsense	probably null
R0242:Ppip5k2	UTSW	1	97,668,816 (GRCm39)	missense	probably damaging	1.00
R0242:Ppip5k2	UTSW	1	97,668,816 (GRCm39)	missense	probably damaging	1.00
R0267:Ppip5k2	UTSW	1	97,656,722 (GRCm39)	missense	probably damaging	1.00
R0281:Ppip5k2	UTSW	1	97,644,278 (GRCm39)	missense	possibly damaging	0.95
R0373:Ppip5k2	UTSW	1	97,668,262 (GRCm39)	nonsense	probably null
R0402:Ppip5k2	UTSW	1	97,647,579 (GRCm39)	missense	probably benign	0.00
R0423:Ppip5k2	UTSW	1	97,689,152 (GRCm39)	missense	possibly damaging	0.95
R0613:Ppip5k2	UTSW	1	97,680,465 (GRCm39)	nonsense	probably null
R0751:Ppip5k2	UTSW	1	97,677,377 (GRCm39)	nonsense	probably null
R1121:Ppip5k2	UTSW	1	97,684,585 (GRCm39)	missense	probably damaging	1.00
R1436:Ppip5k2	UTSW	1	97,639,507 (GRCm39)	missense	probably benign	0.04
R1543:Ppip5k2	UTSW	1	97,668,607 (GRCm39)	missense	probably damaging	1.00
R1739:Ppip5k2	UTSW	1	97,656,682 (GRCm39)	missense	probably damaging	1.00
R1845:Ppip5k2	UTSW	1	97,651,531 (GRCm39)	missense	possibly damaging	0.74
R2191:Ppip5k2	UTSW	1	97,671,835 (GRCm39)	missense	probably damaging	0.99
R2430:Ppip5k2	UTSW	1	97,662,755 (GRCm39)	missense	probably damaging	1.00
R2762:Ppip5k2	UTSW	1	97,645,234 (GRCm39)	missense	probably damaging	1.00
R3014:Ppip5k2	UTSW	1	97,671,800 (GRCm39)	missense	probably damaging	0.99
R3759:Ppip5k2	UTSW	1	97,683,610 (GRCm39)	critical splice donor site	probably null
R4603:Ppip5k2	UTSW	1	97,682,861 (GRCm39)	missense	probably damaging	1.00
R4772:Ppip5k2	UTSW	1	97,648,792 (GRCm39)	unclassified	probably benign
R4951:Ppip5k2	UTSW	1	97,639,474 (GRCm39)	missense	possibly damaging	0.77
R5348:Ppip5k2	UTSW	1	97,675,317 (GRCm39)	missense	possibly damaging	0.94
R5350:Ppip5k2	UTSW	1	97,648,853 (GRCm39)	missense	probably damaging	0.98
R5584:Ppip5k2	UTSW	1	97,678,366 (GRCm39)	missense	probably damaging	1.00
R5599:Ppip5k2	UTSW	1	97,668,323 (GRCm39)	missense	probably damaging	1.00
R5883:Ppip5k2	UTSW	1	97,635,535 (GRCm39)	missense	possibly damaging	0.53
R5898:Ppip5k2	UTSW	1	97,671,887 (GRCm39)	intron	probably benign
R6184:Ppip5k2	UTSW	1	97,661,730 (GRCm39)	missense	possibly damaging	0.89
R6221:Ppip5k2	UTSW	1	97,657,753 (GRCm39)	missense	probably damaging	1.00
R6775:Ppip5k2	UTSW	1	97,647,585 (GRCm39)	missense	possibly damaging	0.49
R7250:Ppip5k2	UTSW	1	97,673,187 (GRCm39)	missense	probably benign	0.00
R7329:Ppip5k2	UTSW	1	97,678,478 (GRCm39)	splice site	probably null
R7357:Ppip5k2	UTSW	1	97,686,941 (GRCm39)	missense	possibly damaging	0.91
R7852:Ppip5k2	UTSW	1	97,668,896 (GRCm39)	missense	probably damaging	0.99
R7884:Ppip5k2	UTSW	1	97,668,207 (GRCm39)	missense	probably benign	0.00
R8006:Ppip5k2	UTSW	1	97,661,831 (GRCm39)	missense	probably benign	0.00
R8134:Ppip5k2	UTSW	1	97,672,888 (GRCm39)	missense	probably benign	0.12
R8274:Ppip5k2	UTSW	1	97,686,941 (GRCm39)	missense	possibly damaging	0.91
R8436:Ppip5k2	UTSW	1	97,683,613 (GRCm39)	missense	probably benign
R8440:Ppip5k2	UTSW	1	97,675,276 (GRCm39)	missense	probably damaging	0.99
R8895:Ppip5k2	UTSW	1	97,639,544 (GRCm39)	missense	probably benign
R9017:Ppip5k2	UTSW	1	97,655,139 (GRCm39)	missense	probably damaging	1.00
R9061:Ppip5k2	UTSW	1	97,645,187 (GRCm39)	missense	probably damaging	1.00
R9441:Ppip5k2	UTSW	1	97,672,921 (GRCm39)	missense	probably benign	0.00
R9533:Ppip5k2	UTSW	1	97,661,792 (GRCm39)	missense	probably benign	0.11
R9715:Ppip5k2	UTSW	1	97,677,312 (GRCm39)	missense
R9792:Ppip5k2	UTSW	1	97,671,822 (GRCm39)	nonsense	probably null
R9793:Ppip5k2	UTSW	1	97,671,822 (GRCm39)	nonsense	probably null
R9795:Ppip5k2	UTSW	1	97,671,822 (GRCm39)	nonsense	probably null
Z1177:Ppip5k2	UTSW	1	97,644,330 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CACTGGCAGTTAGTCACCACAGAG -3'
(R):5'- CCTTCAGAGGGGATCTTGCATGAAC -3'

Sequencing Primer
(F):5'- GCAGTTAGTCACCACAGAGTAGTC -3'
(R):5'- CTGGAACAGGGTGCATATGA -3'

Posted On

2014-01-29