Incidental Mutation 'R1265:Sox11'
ID151149
Institutional Source Beutler Lab
Gene Symbol Sox11
Ensembl Gene ENSMUSG00000063632
Gene NameSRY (sex determining region Y)-box 11
Synonyms6230403H02Rik, 1110038H03Rik, end1
MMRRC Submission 039332-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1265 (G1)
Quality Score181
Status Not validated
Chromosome12
Chromosomal Location27334264-27342574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27341736 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 225 (T225A)
Ref Sequence ENSEMBL: ENSMUSP00000078070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079063]
Predicted Effect probably benign
Transcript: ENSMUST00000079063
AA Change: T225A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000078070
Gene: ENSMUSG00000063632
AA Change: T225A

DomainStartEndE-ValueType
HMG 48 118 1.35e-27 SMART
low complexity region 142 174 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
low complexity region 207 213 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 281 309 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may function in the developing nervous system and play a role in tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality with impaired ossification and impaired development of the heart, lung, spleen, stomach, skeleton and pancreas. Mice homozygous for a different knock-out allele exhibit abnormal nervous system development and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,946,722 D316G possibly damaging Het
Aebp1 T C 11: 5,871,740 V713A probably damaging Het
Alg2 T C 4: 47,474,289 probably benign Het
Ank1 T A 8: 23,117,037 V1273E possibly damaging Het
Cntnap5a A G 1: 116,428,518 T760A possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Igf2r A T 17: 12,694,124 V1779E probably damaging Het
Lrp1b C T 2: 41,476,654 V537M probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Ly6h T A 15: 75,566,183 M27L probably benign Het
Nphs2 A G 1: 156,318,747 T173A probably damaging Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr411 T C 11: 74,346,940 I95V probably benign Het
Pdzd7 T C 19: 45,040,685 D82G possibly damaging Het
Pkp2 A G 16: 16,225,304 N76S probably benign Het
Ppip5k2 A G 1: 97,719,900 S976P probably benign Het
Slc38a3 A G 9: 107,651,986 F489S probably damaging Het
Tbx10 T C 19: 3,996,625 F35S probably damaging Het
Tcf4 T C 18: 69,642,932 M40T possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Thsd7a T C 6: 12,317,419 N1630S probably damaging Het
Urb2 A G 8: 124,025,153 D75G probably damaging Het
Other mutations in Sox11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0898:Sox11 UTSW 12 27341225 missense probably damaging 1.00
R2073:Sox11 UTSW 12 27342279 missense possibly damaging 0.91
R2108:Sox11 UTSW 12 27341703 missense probably damaging 1.00
R3620:Sox11 UTSW 12 27341736 missense probably benign 0.03
R3855:Sox11 UTSW 12 27341502 missense probably damaging 0.99
R5681:Sox11 UTSW 12 27341824 missense probably benign
R6288:Sox11 UTSW 12 27342333 missense possibly damaging 0.85
R6933:Sox11 UTSW 12 27341494 missense probably damaging 0.99
R7752:Sox11 UTSW 12 27341440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAACATGAGGTCGTCTGCATCC -3'
(R):5'- GCACATGGCTGATTATCCCGACTAC -3'

Sequencing Primer
(F):5'- TGCTGCCGCTGGATGAG -3'
(R):5'- TGATTATCCCGACTACAAGTACCG -3'
Posted On2014-01-29