Incidental Mutation 'R1266:Olfr1155'
ID151160
Institutional Source Beutler Lab
Gene Symbol Olfr1155
Ensembl Gene ENSMUSG00000075145
Gene Nameolfactory receptor 1155
SynonymsGA_x6K02T2Q125-49426894-49425950, MOR174-10
MMRRC Submission 039333-MU
Accession Numbers

Genbank: NM_146643; MGI: 3030989

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1266 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87941645-87945137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87943533 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 32 (L32M)
Ref Sequence ENSEMBL: ENSMUSP00000149428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099843] [ENSMUST00000214641] [ENSMUST00000215903] [ENSMUST00000216191] [ENSMUST00000216726]
Predicted Effect probably benign
Transcript: ENSMUST00000099843
AA Change: L32M

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097431
Gene: ENSMUSG00000075145
AA Change: L32M

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.7e-44 PFAM
Pfam:7tm_1 43 292 5.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214641
AA Change: L32M

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215903
AA Change: L32M

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000216191
Predicted Effect probably benign
Transcript: ENSMUST00000216726
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob C A 12: 8,006,093 T1492N probably benign Het
Brix1 T C 15: 10,478,761 T191A probably damaging Het
C1qc A G 4: 136,890,357 S143P possibly damaging Het
Crim1 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 78,200,833 probably benign Het
Defa22 G T 8: 21,162,368 V17F probably damaging Het
Fer1l4 T A 2: 156,046,249 T439S possibly damaging Het
Flt3 A G 5: 147,356,860 S469P probably benign Het
Krtap19-9b A T 16: 88,932,052 S54T unknown Het
Ncor1 T C 11: 62,334,040 D798G probably damaging Het
Oosp1 T C 19: 11,667,799 H167R possibly damaging Het
Poln A T 5: 34,133,109 probably null Het
Primpol A T 8: 46,593,699 N187K probably damaging Het
Prr12 A G 7: 45,050,253 probably benign Het
Setd1b A G 5: 123,147,841 T317A unknown Het
Sgo2b G A 8: 63,928,421 T459M probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zfp455 C T 13: 67,206,964 R99* probably null Het
Other mutations in Olfr1155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02507:Olfr1155 APN 2 87942918 nonsense probably null
IGL03245:Olfr1155 APN 2 87942742 missense possibly damaging 0.75
B5639:Olfr1155 UTSW 2 87943598 missense probably benign 0.03
PIT4531001:Olfr1155 UTSW 2 87943227 missense probably damaging 1.00
R0212:Olfr1155 UTSW 2 87943091 missense probably damaging 1.00
R0393:Olfr1155 UTSW 2 87943565 missense possibly damaging 0.62
R1178:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R1180:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R1181:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R1847:Olfr1155 UTSW 2 87942721 splice site probably null
R1998:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R2000:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R4119:Olfr1155 UTSW 2 87943443 missense probably damaging 1.00
R4213:Olfr1155 UTSW 2 87943121 missense probably benign 0.00
R5157:Olfr1155 UTSW 2 87942888 missense probably benign
R5688:Olfr1155 UTSW 2 87943208 missense probably benign 0.02
R5731:Olfr1155 UTSW 2 87943427 missense possibly damaging 0.89
R6064:Olfr1155 UTSW 2 87943484 missense probably benign 0.00
R6372:Olfr1155 UTSW 2 87942975 missense probably benign 0.00
R6505:Olfr1155 UTSW 2 87943174 nonsense probably null
R6555:Olfr1155 UTSW 2 87943288 missense probably damaging 1.00
R6909:Olfr1155 UTSW 2 87942690 missense probably benign 0.27
R7257:Olfr1155 UTSW 2 87943571 missense probably damaging 1.00
R8037:Olfr1155 UTSW 2 87942975 missense probably benign 0.00
R8367:Olfr1155 UTSW 2 87943097 missense possibly damaging 0.75
Z1088:Olfr1155 UTSW 2 87943448 missense probably damaging 1.00
Z1176:Olfr1155 UTSW 2 87943209 missense possibly damaging 0.57
Z1176:Olfr1155 UTSW 2 87943467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGAGCAATGATGGAGGAATAGC -3'
(R):5'- GTGAAAACACAGTAGTTTGGGGAGGT -3'

Sequencing Primer
(F):5'- CAATGATGGAGGAATAGCAGAAATC -3'
(R):5'- GCTTACTGATAGTCAATTAGGCATAC -3'
Posted On2014-01-29