Incidental Mutation 'R1266:Prr12'
ID151166
Institutional Source Beutler Lab
Gene Symbol Prr12
Ensembl Gene ENSMUSG00000046574
Gene Nameproline rich 12
Synonyms
MMRRC Submission 039333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R1266 (G1)
Quality Score171
Status Not validated
Chromosome7
Chromosomal Location45027563-45052881 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 45050253 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007981] [ENSMUST00000057293] [ENSMUST00000209920] [ENSMUST00000210101] [ENSMUST00000210493] [ENSMUST00000210500] [ENSMUST00000210690] [ENSMUST00000211014] [ENSMUST00000211337]
Predicted Effect probably benign
Transcript: ENSMUST00000007981
SMART Domains Protein: ENSMUSP00000007981
Gene: ENSMUSG00000007837

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GLA 30 97 4.2e-27 SMART
transmembrane domain 112 134 N/A INTRINSIC
low complexity region 156 173 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000057293
AA Change: S105P
SMART Domains Protein: ENSMUSP00000054702
Gene: ENSMUSG00000046574
AA Change: S105P

DomainStartEndE-ValueType
low complexity region 135 150 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 225 242 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
low complexity region 330 376 N/A INTRINSIC
low complexity region 388 413 N/A INTRINSIC
low complexity region 418 444 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
low complexity region 469 487 N/A INTRINSIC
low complexity region 535 559 N/A INTRINSIC
low complexity region 598 616 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
low complexity region 858 871 N/A INTRINSIC
low complexity region 883 896 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 986 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
low complexity region 1059 1070 N/A INTRINSIC
AT_hook 1161 1173 5.74e1 SMART
AT_hook 1193 1205 8.09e0 SMART
low complexity region 1252 1264 N/A INTRINSIC
low complexity region 1308 1328 N/A INTRINSIC
low complexity region 1417 1535 N/A INTRINSIC
low complexity region 1684 1748 N/A INTRINSIC
Pfam:DUF4211 1817 1950 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209417
Predicted Effect probably benign
Transcript: ENSMUST00000209920
Predicted Effect probably benign
Transcript: ENSMUST00000210101
Predicted Effect probably benign
Transcript: ENSMUST00000210493
Predicted Effect probably benign
Transcript: ENSMUST00000210500
Predicted Effect probably benign
Transcript: ENSMUST00000210690
Predicted Effect probably benign
Transcript: ENSMUST00000211014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211084
Predicted Effect probably benign
Transcript: ENSMUST00000211337
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich protein that contains two A-T hook DNA binding domains. A chromosomal translocation and gene fusion between this gene and zinc finger, MIZ-type containing 1 (Gene ID: 57178) may underlie intellectual disability and neuropsychiatric problems in a human patient. Enriched expression of this gene in embryonic mouse brain suggests that this gene may play a role in nervous system development. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob C A 12: 8,006,093 T1492N probably benign Het
Brix1 T C 15: 10,478,761 T191A probably damaging Het
C1qc A G 4: 136,890,357 S143P possibly damaging Het
Crim1 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 78,200,833 probably benign Het
Defa22 G T 8: 21,162,368 V17F probably damaging Het
Fer1l4 T A 2: 156,046,249 T439S possibly damaging Het
Flt3 A G 5: 147,356,860 S469P probably benign Het
Krtap19-9b A T 16: 88,932,052 S54T unknown Het
Ncor1 T C 11: 62,334,040 D798G probably damaging Het
Olfr1155 A T 2: 87,943,533 L32M probably benign Het
Oosp1 T C 19: 11,667,799 H167R possibly damaging Het
Poln A T 5: 34,133,109 probably null Het
Primpol A T 8: 46,593,699 N187K probably damaging Het
Setd1b A G 5: 123,147,841 T317A unknown Het
Sgo2b G A 8: 63,928,421 T459M probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zfp455 C T 13: 67,206,964 R99* probably null Het
Other mutations in Prr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Prr12 APN 7 45047458 missense unknown
IGL01603:Prr12 APN 7 45043485 missense probably damaging 0.96
IGL01941:Prr12 APN 7 45048659 unclassified probably benign
IGL02043:Prr12 APN 7 45050005 unclassified probably benign
IGL02170:Prr12 APN 7 45046188 missense unknown
IGL02494:Prr12 APN 7 45028846 missense unknown
IGL02947:Prr12 APN 7 45048556 missense unknown
R0128:Prr12 UTSW 7 45050039 unclassified probably benign
R0255:Prr12 UTSW 7 45049991 unclassified probably benign
R0556:Prr12 UTSW 7 45030669 missense unknown
R1168:Prr12 UTSW 7 45029047 missense unknown
R1374:Prr12 UTSW 7 45046218 missense unknown
R1531:Prr12 UTSW 7 45028530 missense unknown
R1537:Prr12 UTSW 7 45028942 missense unknown
R1572:Prr12 UTSW 7 45028800 missense unknown
R1617:Prr12 UTSW 7 45049594 unclassified probably benign
R1647:Prr12 UTSW 7 45034192 missense probably benign 0.20
R1694:Prr12 UTSW 7 45028579 missense unknown
R1732:Prr12 UTSW 7 45048356 missense unknown
R1819:Prr12 UTSW 7 45048697 unclassified probably benign
R2114:Prr12 UTSW 7 45046082 missense unknown
R2210:Prr12 UTSW 7 45049351 unclassified probably benign
R2846:Prr12 UTSW 7 45046012 missense unknown
R2902:Prr12 UTSW 7 45047612 missense unknown
R2985:Prr12 UTSW 7 45046012 missense unknown
R4094:Prr12 UTSW 7 45047947 missense unknown
R4498:Prr12 UTSW 7 45045914 missense unknown
R4523:Prr12 UTSW 7 45048523 missense unknown
R4763:Prr12 UTSW 7 45047695 missense unknown
R4775:Prr12 UTSW 7 45051325 unclassified probably benign
R4995:Prr12 UTSW 7 45051229 unclassified probably benign
R5007:Prr12 UTSW 7 45049801 unclassified probably benign
R5045:Prr12 UTSW 7 45049894 unclassified probably benign
R5184:Prr12 UTSW 7 45046377 missense unknown
R5897:Prr12 UTSW 7 45043384 missense probably damaging 1.00
R6847:Prr12 UTSW 7 45045740 missense unknown
R6912:Prr12 UTSW 7 45048845 unclassified probably benign
R7147:Prr12 UTSW 7 45033850 missense unknown
X0066:Prr12 UTSW 7 45047003 missense unknown
Predicted Primers PCR Primer
(F):5'- GGAAGGCTTCAAGTGGAGCACATC -3'
(R):5'- AGTCCTCCTCTGAACTGAACCTGG -3'

Sequencing Primer
(F):5'- CTTCAAGTGGAGCACATCATGAG -3'
(R):5'- GAACCTGGTTTAGTGCTTTTCC -3'
Posted On2014-01-29