Incidental Mutation 'R1267:Gm13083'
ID151185
Institutional Source Beutler Lab
Gene Symbol Gm13083
Ensembl Gene ENSMUSG00000066688
Gene Namepredicted gene 13083
Synonyms
MMRRC Submission 039334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1267 (G1)
Quality Score209
Status Not validated
Chromosome4
Chromosomal Location143615003-143618595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143615734 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 137 (G137E)
Ref Sequence ENSEMBL: ENSMUSP00000101399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105773]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105773
AA Change: G137E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101399
Gene: ENSMUSG00000066688
AA Change: G137E

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 431 7e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120556
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b G A 1: 36,700,104 S368F probably benign Het
Asb4 T A 6: 5,423,747 V298E probably damaging Het
Ddx28 A G 8: 106,009,917 V503A probably damaging Het
Dock1 T C 7: 134,746,436 Y259H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Nrbp1 A G 5: 31,250,590 K459R probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sntg2 G A 12: 30,245,128 T280M probably benign Het
Stat5b C T 11: 100,798,593 V227M probably benign Het
Taf4 A G 2: 179,929,324 I732T possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Thsd7b T A 1: 129,628,840 probably null Het
Other mutations in Gm13083
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Gm13083 APN 4 143615073 missense probably benign 0.00
IGL02390:Gm13083 APN 4 143615325 missense probably benign 0.29
IGL02676:Gm13083 APN 4 143616097 missense possibly damaging 0.75
IGL03381:Gm13083 APN 4 143617055 splice site probably benign
IGL03410:Gm13083 APN 4 143615281 missense probably benign 0.02
H8562:Gm13083 UTSW 4 143615350 splice site probably benign
PIT4151001:Gm13083 UTSW 4 143616152 nonsense probably null
R0157:Gm13083 UTSW 4 143615796 missense probably damaging 0.98
R0352:Gm13083 UTSW 4 143615989 missense possibly damaging 0.92
R0494:Gm13083 UTSW 4 143616156 missense probably benign 0.33
R0688:Gm13083 UTSW 4 143617357 missense probably benign 0.00
R0884:Gm13083 UTSW 4 143615184 missense probably benign 0.01
R1418:Gm13083 UTSW 4 143616034 missense probably benign 0.15
R1761:Gm13083 UTSW 4 143615868 missense probably benign 0.00
R3148:Gm13083 UTSW 4 143617477 missense probably benign 0.30
R4063:Gm13083 UTSW 4 143615989 missense possibly damaging 0.77
R4115:Gm13083 UTSW 4 143617456 missense probably benign 0.06
R4760:Gm13083 UTSW 4 143617231 missense probably benign 0.04
R5516:Gm13083 UTSW 4 143615683 missense possibly damaging 0.49
R5603:Gm13083 UTSW 4 143617496 nonsense probably null
R5724:Gm13083 UTSW 4 143617456 missense probably benign 0.06
R5796:Gm13083 UTSW 4 143615208 missense probably benign 0.12
R5879:Gm13083 UTSW 4 143617591 missense possibly damaging 0.64
R6181:Gm13083 UTSW 4 143616258 critical splice donor site probably null
R7155:Gm13083 UTSW 4 143616165 missense probably benign 0.01
R7492:Gm13083 UTSW 4 143616174 missense not run
R7913:Gm13083 UTSW 4 143615045 missense possibly damaging 0.87
R7995:Gm13083 UTSW 4 143616000 missense possibly damaging 0.89
R8126:Gm13083 UTSW 4 143617065 missense possibly damaging 0.87
Z1088:Gm13083 UTSW 4 143615232 missense possibly damaging 0.78
Z1177:Gm13083 UTSW 4 143616160 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCTACCCCAGCCACTTGAGAAATG -3'
(R):5'- TCATAGGCAGGAATGGCCCCAAAC -3'

Sequencing Primer
(F):5'- ATGGGTCCTGCAGATTACAC -3'
(R):5'- AGCTTCTCACAGATCACCTG -3'
Posted On2014-01-29