Incidental Mutation 'R1268:Hs6st1'
ID151197
Institutional Source Beutler Lab
Gene Symbol Hs6st1
Ensembl Gene ENSMUSG00000045216
Gene Nameheparan sulfate 6-O-sulfotransferase 1
Synonyms6OST1
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36068400-36106446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36068926 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 90 (V90D)
Ref Sequence ENSEMBL: ENSMUSP00000085499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088174]
Predicted Effect probably damaging
Transcript: ENSMUST00000088174
AA Change: V90D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085499
Gene: ENSMUSG00000045216
AA Change: V90D

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
Pfam:Sulfotransfer_2 79 351 2e-79 PFAM
coiled coil region 352 386 N/A INTRINSIC
Meta Mutation Damage Score 0.9506 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biological activities. This enzyme is a type II integral membrane protein and is responsible for 6-O-sulfation of heparan sulfate. This enzyme does not share significant sequence similarity with other known sulfotransferases. A pseudogene located on chromosome 1 has been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show prenatal loss, stunted growth, dilated alveoli and lower postweaning survival. Homozygotes for another null allele show additional defects in placenta, eye, phalanx and tarsus morphology. Homozygotes for a gene trapallele show altered retinal axon guidance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Hs6st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Hs6st1 APN 1 36103704 missense probably damaging 0.98
IGL01721:Hs6st1 APN 1 36068935 missense probably damaging 1.00
IGL02123:Hs6st1 APN 1 36103871 missense possibly damaging 0.84
IGL02498:Hs6st1 APN 1 36103740 missense probably damaging 1.00
IGL02662:Hs6st1 APN 1 36103812 nonsense probably null
IGL02730:Hs6st1 APN 1 36103628 missense probably damaging 1.00
R0359:Hs6st1 UTSW 1 36069185 critical splice donor site probably null
R0360:Hs6st1 UTSW 1 36069185 critical splice donor site probably null
R1355:Hs6st1 UTSW 1 36103576 missense probably damaging 1.00
R1521:Hs6st1 UTSW 1 36068886 missense probably damaging 0.99
R1942:Hs6st1 UTSW 1 36068722 missense probably benign
R2364:Hs6st1 UTSW 1 36068719 missense probably benign 0.05
R4418:Hs6st1 UTSW 1 36104027 missense probably damaging 1.00
R4570:Hs6st1 UTSW 1 36103547 missense possibly damaging 0.84
R5319:Hs6st1 UTSW 1 36104178 missense probably benign 0.01
R5370:Hs6st1 UTSW 1 36069081 missense probably damaging 0.99
R5567:Hs6st1 UTSW 1 36103638 missense probably benign 0.06
R5570:Hs6st1 UTSW 1 36103638 missense probably benign 0.06
R5668:Hs6st1 UTSW 1 36103889 missense probably damaging 0.98
R6966:Hs6st1 UTSW 1 36104218 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCATCCTTTACCAGTACGCGG -3'
(R):5'- AGCCAAGCCTGGACCTCTAGTC -3'

Sequencing Primer
(F):5'- CGGACCCACATTACGAGAAA -3'
(R):5'- TGAGTTCGGTCCAGTCAGC -3'
Posted On2014-01-29