Mutagenetix > Incidental Mutations

Incidental Mutation 'R1268:Col5a1'

151199

Institutional Source

Beutler Lab

Gene Symbol

Col5a1

Ensembl Gene

ENSMUSG00000026837

Gene Name

collagen, type V, alpha 1

Synonyms

MMRRC Submission

039335-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1268 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27886425-28039514 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 28002489 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1005 (T1005S)

Ref Sequence

ENSEMBL: ENSMUSP00000028280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028280]

Predicted Effect

unknown
Transcript: ENSMUST00000028280
AA Change: T1005S

SMART Domains

Protein: ENSMUSP00000028280
Gene: ENSMUSG00000026837
AA Change: T1005S

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
TSPN	39	230	5.7e-73	SMART
LamG	98	229	6.86e-3	SMART
low complexity region	259	288	N/A	INTRINSIC
low complexity region	300	314	N/A	INTRINSIC
low complexity region	335	352	N/A	INTRINSIC
low complexity region	374	387	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
internal_repeat_7	443	457	9.97e-7	PROSPERO
Pfam:Collagen	467	519	4e-10	PFAM
Pfam:Collagen	557	619	6.5e-9	PFAM
internal_repeat_2	622	642	1.83e-11	PROSPERO
low complexity region	643	698	N/A	INTRINSIC
low complexity region	712	757	N/A	INTRINSIC
low complexity region	760	793	N/A	INTRINSIC
internal_repeat_5	794	817	3.78e-8	PROSPERO
internal_repeat_7	798	812	9.97e-7	PROSPERO
internal_repeat_8	802	821	8.84e-6	PROSPERO
low complexity region	826	862	N/A	INTRINSIC
internal_repeat_3	865	889	2.79e-10	PROSPERO
internal_repeat_5	869	892	3.78e-8	PROSPERO
low complexity region	895	925	N/A	INTRINSIC
internal_repeat_2	928	948	1.83e-11	PROSPERO
internal_repeat_4	928	948	1.27e-8	PROSPERO
low complexity region	949	979	N/A	INTRINSIC
low complexity region	984	1033	N/A	INTRINSIC
internal_repeat_4	1039	1062	1.27e-8	PROSPERO
internal_repeat_1	1039	1063	5.12e-15	PROSPERO
internal_repeat_3	1048	1072	2.79e-10	PROSPERO
internal_repeat_6	1049	1072	1.13e-7	PROSPERO
low complexity region	1075	1117	N/A	INTRINSIC
low complexity region	1134	1165	N/A	INTRINSIC
low complexity region	1174	1193	N/A	INTRINSIC
internal_repeat_8	1195	1214	8.84e-6	PROSPERO
low complexity region	1215	1243	N/A	INTRINSIC
low complexity region	1249	1282	N/A	INTRINSIC
low complexity region	1285	1421	N/A	INTRINSIC
internal_repeat_1	1423	1447	5.12e-15	PROSPERO
Pfam:Collagen	1460	1529	8.4e-9	PFAM
Pfam:Collagen	1513	1575	1.2e-9	PFAM
COLFI	1608	1837	3.33e-153	SMART

Meta Mutation Damage Score

0.0594

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. The encoded procollagen protein occurs commonly as the heterotrimer pro-alpha1(V)-pro-alpha1(V)-pro-alpha2(V). Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10-11 due to cardiovascular insufficiency and lack of collagen fibril formation. Heterozygotes exhibit poorly organized and less dense fibers in the dermis and reduced skin tensile strength and are a model for Ehlers-Danlos Syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	T	C	17: 13,887,986	V1257A	probably damaging	Het
Aplnr	A	G	2: 85,137,431	T267A	possibly damaging	Het
Arap2	A	G	5: 62,730,621	S461P	probably benign	Het
Brpf3	A	G	17: 28,836,556	T1160A	probably damaging	Het
Crebrf	CTTTT	CTTT	17: 26,739,596		probably null	Het
Fmo6	A	T	1: 162,920,517	I326N	probably damaging	Het
Foxp4	G	C	17: 47,880,353		probably benign	Het
Gnat1	A	G	9: 107,675,877		probably benign	Het
Hs6st1	T	A	1: 36,068,926	V90D	probably damaging	Het
Igsf11	A	G	16: 39,024,854	T257A	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Mab21l3	C	T	3: 101,835,047	E66K	possibly damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mybl2	A	G	2: 163,074,716	N429S	probably benign	Het
Mycbp2	G	A	14: 103,208,782	T1837I	probably damaging	Het
Myh7b	C	A	2: 155,614,046	S117*	probably null	Het
Nek1	C	A	8: 61,022,264	A202E	probably damaging	Het
Notum	C	T	11: 120,658,667	W159*	probably null	Het
Ntn1	TCCTCGGC	TC	11: 68,213,133		probably benign	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr1308	G	T	2: 111,960,877	N65K	possibly damaging	Het
Olfr1364	C	T	13: 21,574,328	V43M	probably benign	Het
Olfr1451	T	C	19: 12,999,261	Y92H	possibly damaging	Het
Olfr48	A	G	2: 89,844,154	I273T	probably damaging	Het
Olfr494	A	T	7: 108,367,795	I102F	probably benign	Het
Olfr834	T	C	9: 18,988,356	F123L	probably damaging	Het
Plk4	T	A	3: 40,811,369	V659D	probably damaging	Het
Rbm27	T	C	18: 42,333,302	S866P	probably damaging	Het
Rnaseh2b	A	T	14: 62,372,455	K303N	possibly damaging	Het
Samd9l	C	T	6: 3,376,113	V383I	possibly damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slc35f2	T	A	9: 53,797,913	Y62*	probably null	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Ulk1	A	G	5: 110,790,277	S610P	probably damaging	Het
Ulk4	C	A	9: 121,257,074		probably benign	Het
Vdr	T	C	15: 97,857,475	N389S	probably benign	Het

Other mutations in Col5a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01291:Col5a1	APN	2	27971444	splice site	probably benign
IGL01340:Col5a1	APN	2	27960451	missense	unknown
IGL01938:Col5a1	APN	2	27996873	missense	unknown
IGL02167:Col5a1	APN	2	28018556	missense	probably benign
IGL02670:Col5a1	APN	2	27974715	missense	unknown
IGL02672:Col5a1	APN	2	27974715	missense	unknown
IGL02673:Col5a1	APN	2	27974715	missense	unknown
IGL02832:Col5a1	APN	2	27952340	missense	unknown
IGL03065:Col5a1	APN	2	28032745	missense	possibly damaging	0.61
IGL03196:Col5a1	APN	2	27975598	missense	unknown
PIT4131001:Col5a1	UTSW	2	28024653	missense	probably benign	0.01
PIT4495001:Col5a1	UTSW	2	28024776	missense	unknown
R0136:Col5a1	UTSW	2	28024831	missense	probably damaging	1.00
R0485:Col5a1	UTSW	2	27990097	splice site	probably benign
R0626:Col5a1	UTSW	2	27928243	nonsense	probably null
R0666:Col5a1	UTSW	2	28032685	missense	probably damaging	1.00
R1302:Col5a1	UTSW	2	28005236	missense	probably damaging	1.00
R1416:Col5a1	UTSW	2	27922064	missense	unknown
R1466:Col5a1	UTSW	2	28003846	splice site	probably benign
R1617:Col5a1	UTSW	2	27952381	missense	unknown
R1650:Col5a1	UTSW	2	27922159	missense	unknown
R1663:Col5a1	UTSW	2	27951476	missense	unknown
R1901:Col5a1	UTSW	2	27960444	missense	unknown
R1970:Col5a1	UTSW	2	27986754	missense	unknown
R2377:Col5a1	UTSW	2	27928177	missense	unknown
R2396:Col5a1	UTSW	2	27986729	missense	unknown
R4297:Col5a1	UTSW	2	28017204	critical splice donor site	probably null
R4385:Col5a1	UTSW	2	28024779	missense	probably damaging	1.00
R4803:Col5a1	UTSW	2	28011341	missense	unknown
R4835:Col5a1	UTSW	2	28025644	missense	probably damaging	1.00
R4935:Col5a1	UTSW	2	28024742	missense	probably damaging	1.00
R4994:Col5a1	UTSW	2	28032739	missense	possibly damaging	0.90
R4997:Col5a1	UTSW	2	28032782	nonsense	probably null
R5061:Col5a1	UTSW	2	27952378	missense	unknown
R5088:Col5a1	UTSW	2	28018602	nonsense	probably null
R5089:Col5a1	UTSW	2	28018602	nonsense	probably null
R5090:Col5a1	UTSW	2	28018602	nonsense	probably null
R5114:Col5a1	UTSW	2	28025652	missense	probably damaging	1.00
R5409:Col5a1	UTSW	2	27960445	missense	unknown
R5649:Col5a1	UTSW	2	27951456	missense	unknown
R5699:Col5a1	UTSW	2	27997599	missense	unknown
R5910:Col5a1	UTSW	2	28036888	missense	possibly damaging	0.89
R6053:Col5a1	UTSW	2	28014377	unclassified	probably benign
R6210:Col5a1	UTSW	2	28032621	missense	probably benign	0.04
R6363:Col5a1	UTSW	2	27928195	missense	unknown
R6478:Col5a1	UTSW	2	27952436	missense	unknown
R6600:Col5a1	UTSW	2	27997571	missense	unknown
R7047:Col5a1	UTSW	2	27928084	missense	unknown
R7061:Col5a1	UTSW	2	28025678	nonsense	probably null
R7131:Col5a1	UTSW	2	27929486	missense	unknown
R7202:Col5a1	UTSW	2	27952378	missense	unknown
R7270:Col5a1	UTSW	2	27997585	missense	unknown
R7385:Col5a1	UTSW	2	28024750	missense	unknown
R7492:Col5a1	UTSW	2	27969800	critical splice donor site	probably null
R7570:Col5a1	UTSW	2	27951383	missense	unknown
R7627:Col5a1	UTSW	2	27950653	nonsense	probably null
R8003:Col5a1	UTSW	2	27958328	intron	probably benign
R8011:Col5a1	UTSW	2	27980521	splice site	probably benign
R8073:Col5a1	UTSW	2	27962129	missense	possibly damaging	0.85
R8217:Col5a1	UTSW	2	27922123	missense	unknown
R8879:Col5a1	UTSW	2	28014158	missense	unknown
R8911:Col5a1	UTSW	2	27997618	critical splice donor site	probably null
Z1176:Col5a1	UTSW	2	28002517	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCAAATATGGCAGCCCTCAGCATC -3'
(R):5'- ACAGAAGCCCTGCCTCAGTTCAAG -3'

Sequencing Primer
(F):5'- CACAGCCTCCAGAGAGGTTTATG -3'
(R):5'- CTGAACGTGTGAATTTCAGAGAC -3'

Posted On

2014-01-29