Incidental Mutation 'R1268:Olfr48'
ID151201
Institutional Source Beutler Lab
Gene Symbol Olfr48
Ensembl Gene ENSMUSG00000075072
Gene Nameolfactory receptor 48
SynonymsIC3, MOR232-5, GA_x6K02T2Q125-51285881-51284976
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89841793-89848205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89844154 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 273 (I273T)
Ref Sequence ENSEMBL: ENSMUSP00000150505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099762] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000214428] [ENSMUST00000215613]
Predicted Effect probably damaging
Transcript: ENSMUST00000099762
AA Change: I273T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097350
Gene: ENSMUSG00000075072
AA Change: I273T

DomainStartEndE-ValueType
Pfam:7tm_4 26 299 1e-47 PFAM
Pfam:7tm_1 36 282 8.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111520
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213833
Predicted Effect probably damaging
Transcript: ENSMUST00000214428
AA Change: I273T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000215613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216674
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Olfr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Olfr48 APN 2 89844095 missense probably benign 0.00
IGL02184:Olfr48 APN 2 89844385 missense probably damaging 0.98
IGL02408:Olfr48 APN 2 89844971 start codon destroyed probably benign 0.04
IGL02437:Olfr48 APN 2 89844784 missense probably damaging 0.98
IGL02985:Olfr48 APN 2 89844340 missense possibly damaging 0.66
IGL03230:Olfr48 APN 2 89844113 missense probably benign
IGL03393:Olfr48 APN 2 89844569 missense probably benign 0.00
R0482:Olfr48 UTSW 2 89844169 missense probably benign 0.20
R0555:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R1617:Olfr48 UTSW 2 89844254 missense probably benign 0.03
R3552:Olfr48 UTSW 2 89844343 missense possibly damaging 0.53
R4172:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4173:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4174:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R5540:Olfr48 UTSW 2 89844667 missense probably damaging 1.00
R5909:Olfr48 UTSW 2 89844391 missense possibly damaging 0.89
R5941:Olfr48 UTSW 2 89844515 missense probably benign 0.07
R7425:Olfr48 UTSW 2 89844445 missense probably damaging 0.99
R7445:Olfr48 UTSW 2 89844272 missense probably damaging 0.99
R7660:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R7996:Olfr48 UTSW 2 89844415 missense probably benign 0.28
R8026:Olfr48 UTSW 2 89844929 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTTGACCTACCATCAACACACGTT -3'
(R):5'- TGACCTGACCCCTTTGCTGAAAC -3'

Sequencing Primer
(F):5'- GTTAGCATATGCTATTCACTATGCTC -3'
(R):5'- GCCAACAGTGGCTTTATCTG -3'
Posted On2014-01-29